Mol. Cells 2014; 37(1): 74-80
Published online January 27, 2013
https://doi.org/10.14348/molcells.2014.2300
© The Korean Society for Molecular and Cellular Biology
Correspondence to : *Correspondence:
The peroxisome is an intracellular organelle that responds dynamically to environmental changes. Various model organisms have been used to study the roles of peroxisomal proteins in maintaining cellular homeostasis. By taking advantage of the zebrafish model whose early stage of embryogenesis is dependent on yolk components, we examined the developmental roles of the D-bifunctional protein (Dbp), an essential enzyme in the peroxisomal β-oxidation. The knockdown of in zebrafish phenocopied clinical manifestations of its deficiency in human, including defective craniofacial morphogenesis, growth retardation, and abnormal neuronal development. Overexpression of murine rescued the morphological phenotypes induced by knockdown, indicative of conserved roles of Dbp during zebrafish and mammalian development. Knockdown of impaired normal development of blood, blood vessels, and most strikingly, endoderm-derived organs including the liver and pancreas - a phenotype not reported elsewhere in connection with peroxisome dysfunction. Taken together, our results demonstrate for the first time that zebrafish might be a useful model animal to study the role of peroxisomes during vertebrate development.
Keywords D-bifunctional protein, embryogenesis, model organism, peroxisome, zebrafish
Peroxisomes perform crucial functions to maintain cellular homeostasis (Islinger et al., 2012; Van Veldhoven, 2010). Animal models of peroxisome dysfunction, at the level of its biogenesis or separately at an individual enzyme level, were generated to elucidate the molecular mechanisms responsible for disease phenotypes in humans (Baes and Van Veldhoven, 2012). In particular, knockout mouse models provided convincing evidence showing that peroxisome is an active, multifunctional organelle communicating in response to environmental changes with other cellular compartments for maintaining normal physiological functions (Baes and Veldhoven, 2012; Faust et al., 2011; Huyghe etal., 2006). In mice, peroxisome dysfunction affects mitochondrion and Endoplasmic Reticulum (Thoms et al., 2009). However, mice develop in utero and receive nutrients from their mother through the umbilical cord during embryogenesis, making it difficult to gain adequate access to developing embryos. Additionally, such dependence makes it difficult to interpret developmental changes associated with metabolic alterations contributed solely by peroxisome dysfunction. The zebrafish is a well-established genetic and developmental model for studying human-diseases, particularly since its embryos are transparent and develop fast ex utero consuming only the yolk during the initial stages of development (Lieschke and Currie, 2007).
In this study, we examined whether zebrafish embryogenesis can be used as an effective in vivo model for studying peroxisome function, which might permit an organism-level analysis while providing mechanistic insights into development. Specifically, we analyzed the developmental roles of D-bifunctional protein (DBP, also known as 17-β-hydroxysteroid dehydrogenase 4), a peroxisomal enzyme involved in β-oxidation of fatty acids that generates acetyl-CoA and short-chain acyl CoA for intracellular energy and metabolic homeostasis (Moller et al., 2001). Mutations in humans may lead to DBP deficiency in which severe neonatal abnormalities, including growth retardation, neuropathy, craniofacial malformation, and hypotonia occur within an early period of life (Meht?l? et al., 2013; Moller et al., 2001; Suzuki et al., 1997; Van Grunsven et al., 1998; 1999). Mice deficient in Dbp exhibited a similar cohort of phenotypes as those found in humans that included severe growth retardation, male infertility and massive mortality within the first two postnatal weeks (Baes et al., 2000; Ferdinandusse et al., 2005; Huyghe et al., 2006; Verheijden et al., 2013). At a molecular level, DBP is the primary enzyme in the peroxisomal β-oxidation pathway that processes both saturated very long chain and branched chain fatty acids.
Here we report that dbp knockdown in zebrafish embryos leads to morphological malformations, defective yolk consumption, abnormal neuronal development, and growth retardation phenotypes similar to those observed in humans with DBP mutations. A detailed analysis also revealed phenotypes not found earlier in humans or mice, including defects in the formation of blood, blood vessels, and cartilage. Strikingly, dbp knockdown nearly blocked digestive organ development. This is probably a result of reduced transcriptional activities critical for functional peroxisomes as well as mitochondrial biogenesis. These morphological phenotypes were rescued by the expression of murine Dbp, indicating its functional conservation between zebrafish and mouse. Taken together, our results demonstrate that zebrafish is a promising animal model that may be used to uncover new roles of peroxisomes during vertebrate development. Our study is the first to demonstrate the developmental consequences of peroxisome dysfunctions by using the zebrafish model.
The zebrafish and their embryos were handled and staged according to standard protocols (Kimmel et al., 1995). Transgenic zebrafish lines were kindly provided by Drs. C-H Kim, HC Park, Y-K Bae, Y Kee and S-Y Choi [islet1:GFP, gfap:EGFP, mbp:EGFP, gata1:RFP, MLS (mitochondria localization sequence)-EGFP], and by the Zebrafish Organogenesis and Mutant Bank (lfabp:DSRED and elastase:GFP). Control (5′-AACATACATCAGTTTAATATATGTA-3′), splicing-blocking (5′-TCGGTGATGAAGAACTGACCTCCGC-3′) and translation-blocking (5′-CGTCGAATCTCAAAGGCACAGACAT-3′) morpholinos (MOs) were purchased from Gene Tools. Approximately 8 ng MO was microinjected at the 1-cell stage of wild type or transgenic zebrafish embryos as previously described (Choe et al., 2011). For rescue experiment, 50 pg in vitro synthesized murine Dbp mRNA (Ambion) was co-injected with dpb MO and resulting phenotypes were documented.
Murine Dbp was amplified using a standard PCR protocol and cloned into AgeI site in modified pcDNA3.1+myc vector. For the rescue experiments, murine Dbp was subcloned into pCS2+ vector between BamHI and SnaBI sites. A 3′ partial zebrafish dbp was PCR amplified. The amplicon was cloned into pCRII-TOPO vector (Invitrogen) and was used to generate antisense probe for in situ hybridization. All the primer sequences used are listed in Table 1.
Embryos at various stages of development were fixed with 4% paraformaldehyde at 4°C overnight, washed 3 times with PBT, and preincubated in 60% isopropanol for 30 minutes. Embryos were then incubated with freshly filtered 0.3% solution of Oil Red-O (Sigma) in 60% isopropanol for 3 hours, rinsed 3 times with PBT and photographed.
In situ hybridization and immunostaining were performed as described previously (Choe et al., 2009). The dpb antisense probe was synthesized using a standard protocol. For immunostaining, antibodies to Znp-1 (1:1,000, DSHB) and acetylated tubulin (1:1,000, Sigma) followed by secondary Alexa Fluorconjugated anti-Mouse antibodies (1:400, Invitrogen) were used. Embryos were imaged with a Leica M165FC microscope equipped with Leica DFC500.
Total RNAs were prepared from 10 embryos at desired developmental stages using Trizol (Ambion) reagent following manufacturer’s instructions. First strand cDNA was synthesized (Roche) and quantitative PCR was performed. All the primer sequences used are listed in Table 1. Gene expression levels relative to that of β-actin, is presented as an average of values from three independent experiments. Statistical significance was determined in Microsoft Excel, and p < 0.05 was considered to be significant.
We first compared protein sequence of zebrafish Dbp with that of human or mouse, and found that DBP is well conserved in vertebrates, especially in the conserved, catalytic domains (Fig. 1A). We next examined dbp expression during zebrafish embryogenesis by performing quantitative RT-PCR. As detected at 2?4 cell-stage embryos, Zebrafish dbp mRNA was found to be maternally delivered (Fig. 2A). Expression level of maternal dbp mRNAs decreased at the onset of zygotic transcription. As embryogenesis proceeded, expression of dbp mRNAs showed recovery and began to increase gradually. We also performed in situ hybridization to examine whether dbp expression is restricted to a specific cell type during zebrafish embryogenesis. In situ hybridization with dbp antisense probe showed dbp was ubiquitously expressed at least from 2-cell stage of embryos (not shown), consistent with maternal deposition of dbp mRNA determined by quantitative RT-PCR.
We used a morpholino (MO)-based knockdown approach to determine the role of Dbp in zebrafish embryogenesis. A splicing-blocking MO effectively reduced the amount of mature dbp mRNA without generating any mis-spliced transcripts that probably underwent nonsense-mediated decay, a well-known process in response to a blockage of a splicing event (Figs. 1B and 2B). Both translation-blocking and splicing-blocking MOs generated morphologically abnormal embryos starting from 1 day post-fertilization (dpf) (Figs. 2C and 2D). Embryos occasionally exhibited curved body axis (not shown). At 2 dpf and later during development, edema was clearly visible in the pericardium and around the yolk. As compared to wild type embryos, the size of the yolk was noticeably larger in dbp knockdown embryos (Figs. 2E?2H). Therefore, defective β-oxidation in the peroxisome resulting from the dbp knockdown likely impaired normal embryogenesis in zebrafish.
Unlike mammals where embryos in utero receive nutrients from mother through the umbilical cord, zebrafish embryos are limited in their energy source to the yolk components for the initial 5 days of development (Flynn et al., 2009). Zebrafish embryos consume the yolk, eventually depleting it by the time they are ready to be fed at about 6?7 dpf. We used Oil Red-O staining to detect neutral lipids stored in developing zebrafish embryos, and found that consistent with a previous report (Schlegel and Stainier, 2006), neutral lipids were largely located in the yolk and tissues such as brain, heart, and muscles for the first 3 days of normal embryonic development (Fig. 3A). Normally developing embryos consumed most yolk lipids by 4 dpf and almost completely depleted them at 5 dpf (Figs. 3C and 3E). In contrast, dbp knockdown embryos failed to use much of the yolk lipids, as was evident starting at 3 dpf (Figs. 3B, 3D, and 3F). Therefore, peroxisomal β-oxidation may constitute a key component for yolk consumption that supports embryonic growth during development.
DBP deficiency in humans has been shown to result in neuropathy including demyelination (Moller et al., 2001; van Grunsven et al., 1999). We explored whether dbp knockdown generates neuronal abnormality with characteristics similar to that of DBP deficiency in human. Analysis of transgenic zebrafish expressing green fluorescent protein (GFP) in primary motor neurons (islet1:GFP) of the central nervous system (CNS) indicated normal GFP expression in dbp knockdown embryos (not shown). This suggested that Dbp might not be required for motor neuron specification in the CNS. However, Znp1, an axonal marker, was affected, featuring discontinued CaP projections occasionally in the trunk (Figs. 3G and 3H). Additionally, severe suppressionof motor axon differentiation in the trunk was also detected in dbp knockdown embryos (Figs. 3I and 3J). Further, GFP expression driven by the promoter of myelin basic protein in Schwann cells of the control mbp:EGFP transgenic zebrafish was almost abrogated in dbp knockdown embryos (Figs. 3K and 3L). These results strongly suggest that the zebrafish Dbp may act similarly to that in mice and humans to promote neuronal development and integrity (Moller et al., 2001; van Grunsven et al., 1999; Verheijden et al., 2013).
While using various transgenic lines to detect tissue-specific abnormalities upon dbp knockdown, we discovered several developmental programs being impaired in addition to observing the phenotypes expected based on that found in mice and human (Baes and Van Veldhoven, 2012; Huyghe et al., 2006; Van Veldhoven et al., 2010). For examples, the numbers of red blood cells were reduced (detected by the gata1:RFP line, Figs. 4A and 4B) and blood vessels were abnormally patterned (by the fli1:EGFP line, Figs. 4C and 4D) in dbp knockdown embryos. Additionally, abnormal cartilage formation was also observed (not shown). Starting from 3 dpf, both liver and pancreas (by the lfabp:DSRED and elastase:GFP lines, respectively) developed poorly in dbp knockdown embryos (Figs. 4E?4H). In situ hybridization showed that expression of foxa3, a marker of early endodermal organs, was severely reduced or absent in liver and pancreas of dbp knockdown embryos (not shown). These results demonstrated that dbp knockdown in zebrafish impaired a number of developmental programs including those that have not been previously reported in connection with peroxisome dysfunction in humans or mice.
Since dbp knockdown may also affect other peroxisomal functions that confer abnormality on developing embryos, we next examined expression of various genes important in major peroxisomal pathways. We found no differences in the expression of other enzymes in the β-oxidation pathway including acox1, scp2a, and scp2b between wild type and DBP knockdown embryos (not shown). In contrast, mRNA expression of the enzymes involved in the synthesis of ether phospholipids, such as gnpatl and agps, was significantly down-regulated in dbp knockdown embryos at 1 dpf (Figs. 5A and 5B). We also found that expression of pex5, the major carrier of peroxisome-targeted proteins, was significantly down-regulated starting from 2 dpf during development (Fig. 5C). Similarly, dbp knockdown also down-regulated expression of transcription factors known as upstream regulators of mitochondrial biogenesis (Figs. 5D?5F). These results suggested the presence of cross-talk between different functions of peroxisome. Additionally, our results suggest that dysfunctional peroxisome may affect other metabolic organelles such as mitochondria, potentially inducing phenotypic exacerbation as observed at later stages of development.
During the course of experiments, we noticed that morphological phenotypes were closely related to other abnormalities described. Since we found a significant homology between mice and zebrafish DBP protein sequences (Fig. 1), we used murine Dbp to rescue morphological defects observed in dbp knockdown embryos. As expected, murine Dbp over-expression efficiently rescued developmental abnormalities caused by dbp knockdown in zebrafish embryos (Fig. 5G). These results demonstrated that the observed phenotypes were specifically induced by dbp knockdown. Our results clearly indicated conserved functions of DBP in zebrafish and mammals.
In the study reported here, we assessed whether zebrafish can be used as an in vivo model for examining peroxisome functions by examining developmental roles of Dbp. We found that dbp knockdown in zebrafish gave rise to a phenotypic spectrum similar to that found in human patients. In particular, clinical symptoms such as growth retardation, neuropathy, and craniofacial disfiguration in human patients were recapitulated in dbp-knockdown zebrafish embryos that displayed reduced yolk consumption, abnormal neuronal development, and cartilage malformation. Interestingly, phenotypes not found in previous mammalian models were also observed. In addition to defective blood and vessel formation, we found that dbp knockdown nearly blocked digestive system development. Although cases of hepatomegaly associated with peroxisome dysfunction in humans have been reported (Roels et al., 1993), severe defects in the development of digestive organs have not been observed in other organisms. Our results illustrate the usefulness of the zebrafish system in analyzing the role of metabolic pathways in development and diseases.
While DBP deficiency in mammals leads to compensatory activation of several peroxisomal enzymes, dbp knockdown in zebrafish did not affect expression of enzymes in the peroxisomal β-oxidation pathway. Instead, we found decreased expression of genes involved in other peroxisomal pathways, such as the import of peroxisomal matrix proteins and synthesis of ether phospholipids. This phenotypic difference between zebrafish and mammals may at least in part be due to the differences in stages of development analyzed. We found dbp knockdown-mediated transcriptional changes as early as 1dpf when most organs were yet to be formed, while DBP-deficient mice or human patients were examined at single organ/tissue (liver, brain, plasma in most cases) levels at several weeks of postnatal age (Baes et al., 2000; Ferdinandusse et al., 2005; Huyghe et al., 2006; Moller et al., 2001; Suzuki et al., 1997; van Grunsven et al., 1998; 1999). Accordingly, we found that phenotypes of developing zebrafish embryos with dbp knockdown described in this study were far more severe than those reported in DBP-deficient mammals.
We also analyzed the possibility that impaired β-oxidation in the peroxisome due to dbp knockdown may interfere with mitochondrial biogenesis, analogous to previous reports of abnormal mitochondrial morphologies observed in instances of peroxisome dysfunctions (Baes et al., 1997; Baumgart et al., 2001; Dirkx et al., 2005; Muller-Hocker et al., 1984), dbp knockdown decreased expression of pgc1α, pparα and esrra starting at 2 dpf. Given the importance of these genes regulating a number of pathways in mitochondria and peroxisomes, this result suggests that metabolic disturbance induced by peroxisomal β-oxidation may trigger to transcriptional suppression of upstream factors by an unknown feedback mechanism. Nonetheless, our results suggest that a functional link between the peroxisome and other metabolic organelles including mitochondria may be a critical factor for normal animal development.
In conclusion, the zebrafish system with metabolism confined within itself during early development may be an attractive animal model to analyze the molecular basis and physiological consequences of peroxisomal dysfunctions.
. Primer list and its sequences used in real-time PCR, cDNA cloning of dbp, or efficacy test for dbp splicing-blocking morpholino
Gene name | Forward primer (5′ to 3′) | Reverse primer (5′ to 3′) |
---|---|---|
mDbp | ACCGGTATGGCTTCGCCGCTGAGGTTCG | ACCGGTTCAGAGCTTGGCATAGTCTTTAAG |
dbp | CGGTCTATCCTGGTCAGTCT | TTTCCCCATCACCACCTCCA |
gnpatl | CGTCTTCCTCAGAGCCATTC | CACTCTGAACTCGTTCTGGTC |
agps | GTCCTCCATATTCACCTCATTC | CACTCTCTTATTATCCTCTCCT |
pex5 | GGGAGAGAGAGAAAGAGAGT | ACAGAGAGTGCGGCAGAGAAA |
pgcla | CCTCCTTCCTCTCAGCTCT | CCCTCTCACATTCCCGTTTC |
pparab | GGAGAAGCTAAGGTTGAAGG | GGGCACAGATTTGGGGAATTC |
esrra | GTTCTGGATGAGGAGATGTC | TGAGGAGAGGCAGGGTGAG |
β-actin | ACCTCATGAAGATCCTGACC | TGCTAATCCACATCTGCTGG |
dbp-C | TCTCCAATCCTCCACGGTTTGTGTT | CGTTCCTCAAACTATGAGCGTTAGACAGA |
dbp-E1 | CATCTCATCATGTCTGTGCC | |
dbp-E4 | CTTCTCTCCATCCTCCACT |
Mol. Cells 2014; 37(1): 74-80
Published online January 31, 2014 https://doi.org/10.14348/molcells.2014.2300
Copyright © The Korean Society for Molecular and Cellular Biology.
Yong-Il Kim1,4, Sushil Bhandari1,4, Joon No Lee1,4, Kyeong-Won Yoo1,2, Se-Jin Kim1, Gi-Su Oh1, Hyung-Jin Kim1, Meyoung Cho3, Jong-Young Kwak2, Hong-Seob So1, Raekil Park1,*, and Seong-Kyu Choe1,*
1Center for Metabolic Function Regulation, and Department of Microbiology, School of Medicine, Wonkwang University, Iksan 570-749,Korea, 2Immune-network Pioneer Research Center, Department of Biochemistry, College of Medicine, Dong-A University, Busan 602-714,Korea, 3Department of Internal Medicine, Gunsan Medical Center, Gunsan 573-713Korea, 4These authors contributed equally to this work.
Correspondence to:*Correspondence:
The peroxisome is an intracellular organelle that responds dynamically to environmental changes. Various model organisms have been used to study the roles of peroxisomal proteins in maintaining cellular homeostasis. By taking advantage of the zebrafish model whose early stage of embryogenesis is dependent on yolk components, we examined the developmental roles of the D-bifunctional protein (Dbp), an essential enzyme in the peroxisomal β-oxidation. The knockdown of in zebrafish phenocopied clinical manifestations of its deficiency in human, including defective craniofacial morphogenesis, growth retardation, and abnormal neuronal development. Overexpression of murine rescued the morphological phenotypes induced by knockdown, indicative of conserved roles of Dbp during zebrafish and mammalian development. Knockdown of impaired normal development of blood, blood vessels, and most strikingly, endoderm-derived organs including the liver and pancreas - a phenotype not reported elsewhere in connection with peroxisome dysfunction. Taken together, our results demonstrate for the first time that zebrafish might be a useful model animal to study the role of peroxisomes during vertebrate development.
Keywords: D-bifunctional protein, embryogenesis, model organism, peroxisome, zebrafish
Peroxisomes perform crucial functions to maintain cellular homeostasis (Islinger et al., 2012; Van Veldhoven, 2010). Animal models of peroxisome dysfunction, at the level of its biogenesis or separately at an individual enzyme level, were generated to elucidate the molecular mechanisms responsible for disease phenotypes in humans (Baes and Van Veldhoven, 2012). In particular, knockout mouse models provided convincing evidence showing that peroxisome is an active, multifunctional organelle communicating in response to environmental changes with other cellular compartments for maintaining normal physiological functions (Baes and Veldhoven, 2012; Faust et al., 2011; Huyghe etal., 2006). In mice, peroxisome dysfunction affects mitochondrion and Endoplasmic Reticulum (Thoms et al., 2009). However, mice develop in utero and receive nutrients from their mother through the umbilical cord during embryogenesis, making it difficult to gain adequate access to developing embryos. Additionally, such dependence makes it difficult to interpret developmental changes associated with metabolic alterations contributed solely by peroxisome dysfunction. The zebrafish is a well-established genetic and developmental model for studying human-diseases, particularly since its embryos are transparent and develop fast ex utero consuming only the yolk during the initial stages of development (Lieschke and Currie, 2007).
In this study, we examined whether zebrafish embryogenesis can be used as an effective in vivo model for studying peroxisome function, which might permit an organism-level analysis while providing mechanistic insights into development. Specifically, we analyzed the developmental roles of D-bifunctional protein (DBP, also known as 17-β-hydroxysteroid dehydrogenase 4), a peroxisomal enzyme involved in β-oxidation of fatty acids that generates acetyl-CoA and short-chain acyl CoA for intracellular energy and metabolic homeostasis (Moller et al., 2001). Mutations in humans may lead to DBP deficiency in which severe neonatal abnormalities, including growth retardation, neuropathy, craniofacial malformation, and hypotonia occur within an early period of life (Meht?l? et al., 2013; Moller et al., 2001; Suzuki et al., 1997; Van Grunsven et al., 1998; 1999). Mice deficient in Dbp exhibited a similar cohort of phenotypes as those found in humans that included severe growth retardation, male infertility and massive mortality within the first two postnatal weeks (Baes et al., 2000; Ferdinandusse et al., 2005; Huyghe et al., 2006; Verheijden et al., 2013). At a molecular level, DBP is the primary enzyme in the peroxisomal β-oxidation pathway that processes both saturated very long chain and branched chain fatty acids.
Here we report that dbp knockdown in zebrafish embryos leads to morphological malformations, defective yolk consumption, abnormal neuronal development, and growth retardation phenotypes similar to those observed in humans with DBP mutations. A detailed analysis also revealed phenotypes not found earlier in humans or mice, including defects in the formation of blood, blood vessels, and cartilage. Strikingly, dbp knockdown nearly blocked digestive organ development. This is probably a result of reduced transcriptional activities critical for functional peroxisomes as well as mitochondrial biogenesis. These morphological phenotypes were rescued by the expression of murine Dbp, indicating its functional conservation between zebrafish and mouse. Taken together, our results demonstrate that zebrafish is a promising animal model that may be used to uncover new roles of peroxisomes during vertebrate development. Our study is the first to demonstrate the developmental consequences of peroxisome dysfunctions by using the zebrafish model.
The zebrafish and their embryos were handled and staged according to standard protocols (Kimmel et al., 1995). Transgenic zebrafish lines were kindly provided by Drs. C-H Kim, HC Park, Y-K Bae, Y Kee and S-Y Choi [islet1:GFP, gfap:EGFP, mbp:EGFP, gata1:RFP, MLS (mitochondria localization sequence)-EGFP], and by the Zebrafish Organogenesis and Mutant Bank (lfabp:DSRED and elastase:GFP). Control (5′-AACATACATCAGTTTAATATATGTA-3′), splicing-blocking (5′-TCGGTGATGAAGAACTGACCTCCGC-3′) and translation-blocking (5′-CGTCGAATCTCAAAGGCACAGACAT-3′) morpholinos (MOs) were purchased from Gene Tools. Approximately 8 ng MO was microinjected at the 1-cell stage of wild type or transgenic zebrafish embryos as previously described (Choe et al., 2011). For rescue experiment, 50 pg in vitro synthesized murine Dbp mRNA (Ambion) was co-injected with dpb MO and resulting phenotypes were documented.
Murine Dbp was amplified using a standard PCR protocol and cloned into AgeI site in modified pcDNA3.1+myc vector. For the rescue experiments, murine Dbp was subcloned into pCS2+ vector between BamHI and SnaBI sites. A 3′ partial zebrafish dbp was PCR amplified. The amplicon was cloned into pCRII-TOPO vector (Invitrogen) and was used to generate antisense probe for in situ hybridization. All the primer sequences used are listed in Table 1.
Embryos at various stages of development were fixed with 4% paraformaldehyde at 4°C overnight, washed 3 times with PBT, and preincubated in 60% isopropanol for 30 minutes. Embryos were then incubated with freshly filtered 0.3% solution of Oil Red-O (Sigma) in 60% isopropanol for 3 hours, rinsed 3 times with PBT and photographed.
In situ hybridization and immunostaining were performed as described previously (Choe et al., 2009). The dpb antisense probe was synthesized using a standard protocol. For immunostaining, antibodies to Znp-1 (1:1,000, DSHB) and acetylated tubulin (1:1,000, Sigma) followed by secondary Alexa Fluorconjugated anti-Mouse antibodies (1:400, Invitrogen) were used. Embryos were imaged with a Leica M165FC microscope equipped with Leica DFC500.
Total RNAs were prepared from 10 embryos at desired developmental stages using Trizol (Ambion) reagent following manufacturer’s instructions. First strand cDNA was synthesized (Roche) and quantitative PCR was performed. All the primer sequences used are listed in Table 1. Gene expression levels relative to that of β-actin, is presented as an average of values from three independent experiments. Statistical significance was determined in Microsoft Excel, and p < 0.05 was considered to be significant.
We first compared protein sequence of zebrafish Dbp with that of human or mouse, and found that DBP is well conserved in vertebrates, especially in the conserved, catalytic domains (Fig. 1A). We next examined dbp expression during zebrafish embryogenesis by performing quantitative RT-PCR. As detected at 2?4 cell-stage embryos, Zebrafish dbp mRNA was found to be maternally delivered (Fig. 2A). Expression level of maternal dbp mRNAs decreased at the onset of zygotic transcription. As embryogenesis proceeded, expression of dbp mRNAs showed recovery and began to increase gradually. We also performed in situ hybridization to examine whether dbp expression is restricted to a specific cell type during zebrafish embryogenesis. In situ hybridization with dbp antisense probe showed dbp was ubiquitously expressed at least from 2-cell stage of embryos (not shown), consistent with maternal deposition of dbp mRNA determined by quantitative RT-PCR.
We used a morpholino (MO)-based knockdown approach to determine the role of Dbp in zebrafish embryogenesis. A splicing-blocking MO effectively reduced the amount of mature dbp mRNA without generating any mis-spliced transcripts that probably underwent nonsense-mediated decay, a well-known process in response to a blockage of a splicing event (Figs. 1B and 2B). Both translation-blocking and splicing-blocking MOs generated morphologically abnormal embryos starting from 1 day post-fertilization (dpf) (Figs. 2C and 2D). Embryos occasionally exhibited curved body axis (not shown). At 2 dpf and later during development, edema was clearly visible in the pericardium and around the yolk. As compared to wild type embryos, the size of the yolk was noticeably larger in dbp knockdown embryos (Figs. 2E?2H). Therefore, defective β-oxidation in the peroxisome resulting from the dbp knockdown likely impaired normal embryogenesis in zebrafish.
Unlike mammals where embryos in utero receive nutrients from mother through the umbilical cord, zebrafish embryos are limited in their energy source to the yolk components for the initial 5 days of development (Flynn et al., 2009). Zebrafish embryos consume the yolk, eventually depleting it by the time they are ready to be fed at about 6?7 dpf. We used Oil Red-O staining to detect neutral lipids stored in developing zebrafish embryos, and found that consistent with a previous report (Schlegel and Stainier, 2006), neutral lipids were largely located in the yolk and tissues such as brain, heart, and muscles for the first 3 days of normal embryonic development (Fig. 3A). Normally developing embryos consumed most yolk lipids by 4 dpf and almost completely depleted them at 5 dpf (Figs. 3C and 3E). In contrast, dbp knockdown embryos failed to use much of the yolk lipids, as was evident starting at 3 dpf (Figs. 3B, 3D, and 3F). Therefore, peroxisomal β-oxidation may constitute a key component for yolk consumption that supports embryonic growth during development.
DBP deficiency in humans has been shown to result in neuropathy including demyelination (Moller et al., 2001; van Grunsven et al., 1999). We explored whether dbp knockdown generates neuronal abnormality with characteristics similar to that of DBP deficiency in human. Analysis of transgenic zebrafish expressing green fluorescent protein (GFP) in primary motor neurons (islet1:GFP) of the central nervous system (CNS) indicated normal GFP expression in dbp knockdown embryos (not shown). This suggested that Dbp might not be required for motor neuron specification in the CNS. However, Znp1, an axonal marker, was affected, featuring discontinued CaP projections occasionally in the trunk (Figs. 3G and 3H). Additionally, severe suppressionof motor axon differentiation in the trunk was also detected in dbp knockdown embryos (Figs. 3I and 3J). Further, GFP expression driven by the promoter of myelin basic protein in Schwann cells of the control mbp:EGFP transgenic zebrafish was almost abrogated in dbp knockdown embryos (Figs. 3K and 3L). These results strongly suggest that the zebrafish Dbp may act similarly to that in mice and humans to promote neuronal development and integrity (Moller et al., 2001; van Grunsven et al., 1999; Verheijden et al., 2013).
While using various transgenic lines to detect tissue-specific abnormalities upon dbp knockdown, we discovered several developmental programs being impaired in addition to observing the phenotypes expected based on that found in mice and human (Baes and Van Veldhoven, 2012; Huyghe et al., 2006; Van Veldhoven et al., 2010). For examples, the numbers of red blood cells were reduced (detected by the gata1:RFP line, Figs. 4A and 4B) and blood vessels were abnormally patterned (by the fli1:EGFP line, Figs. 4C and 4D) in dbp knockdown embryos. Additionally, abnormal cartilage formation was also observed (not shown). Starting from 3 dpf, both liver and pancreas (by the lfabp:DSRED and elastase:GFP lines, respectively) developed poorly in dbp knockdown embryos (Figs. 4E?4H). In situ hybridization showed that expression of foxa3, a marker of early endodermal organs, was severely reduced or absent in liver and pancreas of dbp knockdown embryos (not shown). These results demonstrated that dbp knockdown in zebrafish impaired a number of developmental programs including those that have not been previously reported in connection with peroxisome dysfunction in humans or mice.
Since dbp knockdown may also affect other peroxisomal functions that confer abnormality on developing embryos, we next examined expression of various genes important in major peroxisomal pathways. We found no differences in the expression of other enzymes in the β-oxidation pathway including acox1, scp2a, and scp2b between wild type and DBP knockdown embryos (not shown). In contrast, mRNA expression of the enzymes involved in the synthesis of ether phospholipids, such as gnpatl and agps, was significantly down-regulated in dbp knockdown embryos at 1 dpf (Figs. 5A and 5B). We also found that expression of pex5, the major carrier of peroxisome-targeted proteins, was significantly down-regulated starting from 2 dpf during development (Fig. 5C). Similarly, dbp knockdown also down-regulated expression of transcription factors known as upstream regulators of mitochondrial biogenesis (Figs. 5D?5F). These results suggested the presence of cross-talk between different functions of peroxisome. Additionally, our results suggest that dysfunctional peroxisome may affect other metabolic organelles such as mitochondria, potentially inducing phenotypic exacerbation as observed at later stages of development.
During the course of experiments, we noticed that morphological phenotypes were closely related to other abnormalities described. Since we found a significant homology between mice and zebrafish DBP protein sequences (Fig. 1), we used murine Dbp to rescue morphological defects observed in dbp knockdown embryos. As expected, murine Dbp over-expression efficiently rescued developmental abnormalities caused by dbp knockdown in zebrafish embryos (Fig. 5G). These results demonstrated that the observed phenotypes were specifically induced by dbp knockdown. Our results clearly indicated conserved functions of DBP in zebrafish and mammals.
In the study reported here, we assessed whether zebrafish can be used as an in vivo model for examining peroxisome functions by examining developmental roles of Dbp. We found that dbp knockdown in zebrafish gave rise to a phenotypic spectrum similar to that found in human patients. In particular, clinical symptoms such as growth retardation, neuropathy, and craniofacial disfiguration in human patients were recapitulated in dbp-knockdown zebrafish embryos that displayed reduced yolk consumption, abnormal neuronal development, and cartilage malformation. Interestingly, phenotypes not found in previous mammalian models were also observed. In addition to defective blood and vessel formation, we found that dbp knockdown nearly blocked digestive system development. Although cases of hepatomegaly associated with peroxisome dysfunction in humans have been reported (Roels et al., 1993), severe defects in the development of digestive organs have not been observed in other organisms. Our results illustrate the usefulness of the zebrafish system in analyzing the role of metabolic pathways in development and diseases.
While DBP deficiency in mammals leads to compensatory activation of several peroxisomal enzymes, dbp knockdown in zebrafish did not affect expression of enzymes in the peroxisomal β-oxidation pathway. Instead, we found decreased expression of genes involved in other peroxisomal pathways, such as the import of peroxisomal matrix proteins and synthesis of ether phospholipids. This phenotypic difference between zebrafish and mammals may at least in part be due to the differences in stages of development analyzed. We found dbp knockdown-mediated transcriptional changes as early as 1dpf when most organs were yet to be formed, while DBP-deficient mice or human patients were examined at single organ/tissue (liver, brain, plasma in most cases) levels at several weeks of postnatal age (Baes et al., 2000; Ferdinandusse et al., 2005; Huyghe et al., 2006; Moller et al., 2001; Suzuki et al., 1997; van Grunsven et al., 1998; 1999). Accordingly, we found that phenotypes of developing zebrafish embryos with dbp knockdown described in this study were far more severe than those reported in DBP-deficient mammals.
We also analyzed the possibility that impaired β-oxidation in the peroxisome due to dbp knockdown may interfere with mitochondrial biogenesis, analogous to previous reports of abnormal mitochondrial morphologies observed in instances of peroxisome dysfunctions (Baes et al., 1997; Baumgart et al., 2001; Dirkx et al., 2005; Muller-Hocker et al., 1984), dbp knockdown decreased expression of pgc1α, pparα and esrra starting at 2 dpf. Given the importance of these genes regulating a number of pathways in mitochondria and peroxisomes, this result suggests that metabolic disturbance induced by peroxisomal β-oxidation may trigger to transcriptional suppression of upstream factors by an unknown feedback mechanism. Nonetheless, our results suggest that a functional link between the peroxisome and other metabolic organelles including mitochondria may be a critical factor for normal animal development.
In conclusion, the zebrafish system with metabolism confined within itself during early development may be an attractive animal model to analyze the molecular basis and physiological consequences of peroxisomal dysfunctions.
. Primer list and its sequences used in real-time PCR, cDNA cloning of dbp, or efficacy test for dbp splicing-blocking morpholino.
Gene name | Forward primer (5′ to 3′) | Reverse primer (5′ to 3′) |
---|---|---|
mDbp | ACCGGTATGGCTTCGCCGCTGAGGTTCG | ACCGGTTCAGAGCTTGGCATAGTCTTTAAG |
dbp | CGGTCTATCCTGGTCAGTCT | TTTCCCCATCACCACCTCCA |
gnpatl | CGTCTTCCTCAGAGCCATTC | CACTCTGAACTCGTTCTGGTC |
agps | GTCCTCCATATTCACCTCATTC | CACTCTCTTATTATCCTCTCCT |
pex5 | GGGAGAGAGAGAAAGAGAGT | ACAGAGAGTGCGGCAGAGAAA |
pgcla | CCTCCTTCCTCTCAGCTCT | CCCTCTCACATTCCCGTTTC |
pparab | GGAGAAGCTAAGGTTGAAGG | GGGCACAGATTTGGGGAATTC |
esrra | GTTCTGGATGAGGAGATGTC | TGAGGAGAGGCAGGGTGAG |
β-actin | ACCTCATGAAGATCCTGACC | TGCTAATCCACATCTGCTGG |
dbp-C | TCTCCAATCCTCCACGGTTTGTGTT | CGTTCCTCAAACTATGAGCGTTAGACAGA |
dbp-E1 | CATCTCATCATGTCTGTGCC | |
dbp-E4 | CTTCTCTCCATCCTCCACT |
Hae-ock Lee*, Hyerim Choe, Kyungwoon Seo, Hyunsook Lee, Jinseon Lee, and Jhingook Kim
Mol. Cells 2010; 29(5): 501-507 https://doi.org/10.1007/s10059-010-0062-7Sang-Ah Lee, Juyeon Lee, Kwanhyeong Kim, Hyunji Moon, Chanhyuk Min, Byeongjin Moon, Deokhwan Kim, Susumin Yang, Hyunjin Park, Gwangrog Lee, Raekil Park, and Daeho Park
Mol. Cells 2021; 44(4): 214-222 https://doi.org/10.14348/molcells.2021.2217Dong-Hyung Cho, Yi Sak Kim, Doo Sin Jo, Seong-Kyu Choe, and Eun-Kyeong Jo
Mol. Cells 2018; 41(1): 55-64 https://doi.org/10.14348/molcells.2018.2245