Mol. Cells 2019; 42(11): 783-793
Published online November 30, 2019
https://doi.org/10.14348/molcells.2019.0104
© The Korean Society for Molecular and Cellular Biology
Correspondence to : shback@ulsan.ac.kr (SHB); jymoon@changwon.ac.kr (JYM)
This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/3.0/.
When endoplasmic reticulum (ER) functions are perturbed, the ER induces several signaling pathways called unfolded protein response to reestablish ER homeostasis through three ER transmembrane proteins: inositol-requiring enzyme 1 (IRE1), PKR-like ER kinase (PERK), and activating transcription factor 6 (ATF6). Although it is important to measure the activity of ATF6 that can indicate the status of the ER, no specific cell-based reporter assay is currently available. Here, we report a new cell-based method for monitoring ER stress based on the cleavage of ATF6α by sequential actions of proteases at the Golgi apparatus during ER stress. A new expressing vector was constructed by using fusion gene of GAL4 DNA binding domain (GAL4DBD) and activation domain derived from herpes simplex virus VP16 protein (VP16AD) followed by a human ATF6α N-terminal deletion variant. During ER stress, the GAL4DBD-VP16AD(GV)-hATF6α deletion variant was cleaved to liberate active transcription activator encompassing GV-hATF6α fragment which could translocate into the nucleus. The translocated GV-hATF6α fragment strongly induced the expression of firefly luciferase in HeLa Luciferase Reporter cell line containing a stably integrated 5X GAL4 site-luciferase gene. The established double stable reporter cell line HLR-GV-hATF6α(333) represents an innovative tool to investigate regulated intramembrane proteolysis of ATF6α. It can substitute active pATF6(N) binding motif-based reporter cell lines.
Keywords activating transcription factor 6, ER stress, GAL4 binding site, luciferase, regulated intramembrane proteolysis, reporter cell line, unfolded protein response
The endoplasmic reticulum (ER) is a specialized cell organelle that plays important roles in the biosynthesis of many membrane proteins and secreted proteins, their posttranslational modifications (assembly, glycosylation, and disulfide bond), calcium storage and gated release, and production of lipids and sterols. When ER functions are perturbed, the ER induces several signaling pathways called unfolded protein response (UPR) to reestablish ER homeostasis (Back and Kaufman, 2012; Ron and Walter, 2007; Wang and Kaufman, 2016).
In UPR, three ER transmembrane proteins, inositol-requiring enzyme 1 (IRE1), PKR-like ER kinase (PERK, EIF2AK3), and activating transcription factor 6 (ATF6), serve as proximal transducers of UPR pathways (Hetz et al., 2011; Ron and Walter, 2007; Rutkowski and Kaufman, 2007; Wek and Cavener, 2007). IRE1 has ER-stress regulated kinase and endonuclease activities that can initiate unconventional splicing of mRNA encoding basic leucine zipper transcription factor X-box binding protein 1 (XBP1) (Hetz and Glimcher, 2009). IRE1-mediated unconventional cytoplasmic splicing removes a 26-nucleotide intron from unspliced Xbp1 mRNA to induce a translational frameshift, producing a fusion protein encoded from two evolutionarily conserved open reading frames (Ron and Walter, 2007). The fusion protein, XBP1s, acts as a potent transcription factor that can activate the expression of UPR target genes involved in protein folding and export from the ER, export and degradation of misfolded proteins, and lipid biosynthesis to resolve ER stress (Back and Kaufman, 2012; Ron and Walter, 2007). Therefore, measurement or observation of the extent of Xbp1 mRNA splicing is a good tool for monitoring IRE1 activation under ER stress condition. Several studies (Back et al., 2006; Iwawaki et al., 2004; Spiotto et al., 2010) have developed reporter systems for monitoring IRE1-mediated Xbp1 mRNA splicing, a partial sequence of Xbp1, including 26-nt ER stress-specific intron fused to the gene encoding firefly luciferase (FLuc) or green fluorescence protein (GFP). During stress, the spliced indicator mRNA is translated into an XBP1ΔC-Fluc or GFP fusion protein that can be detected by its luminescence or fluorescence.
Activated PERK can phosphorylate serine 51 on the α-subunit of heterotrimeric eukaryotic translation initiation factor 2 (eIF2) (Proud, 2005). Phosphorylation of eIF2α in eIF2 complex results in global attenuation of general mRNA translation while simultaneously enhancing the translation of selected mRNAs (such as activating transcription factor 4 [Atf4] mRNA) that contain short upstream open reading frames in their 5′ untranslated regions (5′UTRs) (Pakos-Zebrucka et al., 2016; Wek et al., 2006). Therefore, under ER stress condition, measurement of Atf4 5′UTR-dependet translational activity is a useful tool for monitoring the status of eIF2α phosphorylation. A reporter construct consisting of translational fusions of the Atf4 5′UTR and the luciferase coding region has been reported (Harding et al., 2000). Recently, a transgenic mouse model for monitoring translational activation of ATF4 in response to cellular stress has been developed (Iwawaki et al., 2017). However, in mammalian cells, there are three more eIF2α kinases (general control nonderepressible 2 [GCN2], protein kinase RNA-activated [PKR], and heme-regulated inhibitor kinase [HRI]) that can be activated by distinct stress stimuli (Pakos-Zebrucka et al., 2016; Wek et al., 2006), suggesting that Atf4 5′UTR-mediated translation enhancement does not always represent activation of PERK-dependent eIF2α phosphorylation pathway.
ATF6 is the third proximal transducer of UPR pathways that is encoded by two related genes, Atf6α and Atf6β (Yoshida et al., 1998). The C-terminal of ATF6 protrudes into the ER lumen whereas its N-terminal faces the cytosol. The N-terminal cytosolic part encompasses a transactivation domain and a basic leucine zipper region followed by a 20-amino acid transmembrane domain (Haze et al., 1999). Under normal conditions, the ER luminal domain of ATF6 maintains ATF6 in an inactive state by binding to BiP, a major molecular chaperone in the ER. Upon ER stress, BiP dissociation from the ER luminal domain of ATF6 exposes Golgi localization signals, evoking ATF6 translocation to the Golgi apparatus (Shen et al., 2002). In addition, ER stress can reduce the extent of intra- and inter-molecular disulfide bridges formed between the two conserved cysteine residues in the luminal domain (Nadanaka et al., 2007). These two molecular mechanisms can induce translocated ATF6 proteins to be cleaved by sequential actions of site 1 protease (S1P) and site 2 protease (S2P) at the Golgi apparatus (Shen and Prywes, 2004; Ye et al., 2000), resulting in liberation of a soluble and active transcription factor designated pATF6(N) (Yoshida et al., 2000; 2001). Thus, activation of ATF6 is characterized as one regulated intramembrane proteolysis (RIP). Liberated pATF6(N) transcription factor can enter the nucleus and bind to ER stress-response elements (ERSEs) of genes that encode functions in ER protein folding, endoplasmic reticulum-associated degradation (ERAD), protein secretion, and ER biogenesis (Back and Kaufman, 2012; Yoshida, 2007). Therefore, measurement of ATF6 activation can be another tool for monitoring ER stress. The most commonly utilized assay systems for monitoring ATF6α activation are luciferase reporter constructs driven by tandem copies of either a UPR element (UPRE) (Lee et al., 2002; Wang et al., 2000) or by BiP promoter which contains three ERSE sites (Gallagher et al., 2016; Yoshida et al., 1998). However, both UPRE and ERSE element sequences of these reporter constructs are a consensus DNA binding motif for other transcription factors such as spliced XBP1 or activated ATF6β that can be generated during ER stress (Bommiasamy et al., 2009; Lee et al., 2003; Yamamoto et al., 2007). Therefore, under ER stress, UPRE or BiP promoter-driven luciferase expression can occur by binding of not only activated ATF6α and β but also spliced XBP1 in cell-based assays using these reporter constructs, suggesting that such promoter-based reporter assay will not solely represent activation of ATF6α during ET stress. On the other hand, previous studies (Chen et al., 2002; Wang et al., 2000) have reported that full length ATF6α fused to GAL4 DNA binding domain (GAL4DBD) could activate 5X GAL4 site-luciferase reporter under ER stress. However, it was difficult to detect GAL4DBD-ATF6α protein in immunoblots using SV40 promoter (Wang et al., 2000). In addition, the expression of GAL4DBD-ATF6α protein should be regulated at low level to prevent activation of reporter gene in uninduced cells (Chen et al., 2002). As such, the development of a reporter cell line for monitoring activation of ATF6α under ER stress conditions has not been reported yet.
Thus, the objective of this study was to develop a luciferase reporter cell line that could monitor activation of ATF6α under ER stress conditions. We constructed a new expressing vector using fusion gene of GAL4DBD and activation domain derived from herpes simplex virus VP16 protein (VP16AD) followed by a human ATF6α N-terminal deletion variant that could generate a cytosolic and active transcription activator (encompassing GAL4DBD-VP16AD and cytosolic part of hATF6α) by S1P and S2P-mediated ATF6α cleavage under ER stress conditions. The GAL4DBD-VP16AD(GV)-hATF6α deletion variant expressing construct was stably integrated into HeLa Luciferase Reporter (HLR) cell line containing a stably integrated 5X GAL4 site-luciferase gene. The expressed GAL4DBD-VP16AD(GV)-hATF6α deletion variant was efficiently cleaved in the established double stable reporter cell line in response to ER stress inducers. The active transcription factor encompassing GAL4DBD-VP16AD and cytosolic part of hATF6α can translocate into the nucleus and strongly induce the expression of firefly luciferase gene in the HLR cell line.
pCMV-GAL4DBD-VP16AD-hATF6α full or deletion variants were generated by inserting coding sequences that could express a fusion protein of the GAL4 DNA binding domain (GAL4DBD, amino acids 1?147) and the VP16AD (amino acids 413?490) followed by human ATF6α full length or deletion variants into pcDNA 3.1(+) vector (Invitrogen, USA). The coding sequence fragment of GAL4DBD-VP16AD was amplified from pM3-VP16 vector (Clontech Laboratories, USA) by polymerase chain reaction (PCR) with the following primers: 5′-GGGTTTGCTAGCTTCCTGAAAGATGAAG-3′ and 5′-GGGTTTGATATCCCCACCGTACTCGTCAATTC-3′. cDNAs of human ATF6α full length or deletion variants were obtained from pCGNATF6α full length (Zhu et al., 1997) generously provided by Dr. Ron Prywes (Columbia University, USA) by PCR with the following pairs. Forward primers included hATF6α (full, aa 1?670), 5′-GGGTTTGATATCATGGGGGAGCCGGCTGGGGTTG-3′; hATF6α (aa 93?670), 5′-GGGTTTGATATCCTTCCAGCCTCCTCAAGTTAT-3′; hATF6α (aa 307?670), 5′-GGGTTTGATATCCTAAGGAGACAGCAACGTATGAT-3′; hATF6α (aa 333?670), 5′-GGGTTTGATATCGGGTTAGAGGCGAGATTAAAGGC-3′; hATF6α (aa 362?670), 5′-GGGTTTGATATCGTTGTGTCAGAGAACCAGAG-3′; and hATF6α (aa 374?670): 5′-GGGTTTGATATCCTAAGGAGACAGCAACGTAT-3′. Common reverse primer was 5′-GGGTTTGCGGCCGCCTAAGCGTAATCTGGAACATCGTATGGGTATTGTAATG ACTCAGGGATGG-3′.
To construct pCMV-GAL4DBD-VP16AD-hATF6α full or deletion variants, pCMV-GAL4DBD-VP16AD was generated at first. GAL4DBD-VP16AD PCR fragment digested with NheI and EcoRV restriction enzymes was inserted into pcDNA 3.1(+) vector (Invitrogen) digested with the same restriction endonucleases. Next, pCMV-GAL4DBD-VP16AD-hATF6α full or deletion variants were constructed by inserting hATF6α full or deletion variants’ PCR fragments digested with EcoRV and NotI into pCMV-GAL4DBD-VP16AD plasmid treated with the same restriction enzymes. Clones were confirmed by sequencing.
HLR cells (Agilent Technologies, USA) containing a stably integrated 5X GAL4 binding site of luciferase reporter gene were grown in Dulbecco’s modified Eagle’s medium (Invitrogen) supplemented with 10% fetal bovine serum (Hyclone, USA), 1% glutamax (Invitrogen), 1% penicillin G/streptomycin (Invitrogen), and 0.1 mg/ml of Hygromycin B (Invitrogen).
To generate stably transformed HLR cells expressing GAL4DBD-VP16AD-hATF6αΔN(aa 333?670) under the control of CMV enhancer-promoter, HLR cells were transfected with SspI-digested pCMV-GAL4DBD-VP16AD-hATF6αΔN(aa 333?670) vector. Transformants were selected with both hygromycin B (0.1 mg/ml) and G418 (0.5 mg/ml) antibiotics. Antibiotics-resistant stable cell clones were screened for the activity of firefly luciferase after treatment with dithiothreitol (DTT, 2 mM) as an ER stress inducer as described below. Among several positive clones identified, one clone (#3) that showed the highest firefly luciferase activity after DTT treatment was chosen. Thus, in subsequent experiments, we used a clone named HLR-GV-hATF6α(333) expressing GAL4DBD-VP16AD(GV)-hATF6αΔN(aa 333?670).
HLR cells were plated onto 48-well culture dishes the day before transfection. Expressing plasmids (0.5 μg of pcDNA3.1(+), pCMV-GAL4DBD-VP16AD-hATF6α full or deletion variants) and reference plasmid (0.01 μg of pRL-CMV; Promega, USA) were transfected into HLR cells using Fugene 6 (Promega) for 24 h. These cells were then further incubated with fresh medium with DMSO or ER stress inducers (1 μg tunicamycin [Tm] or 5 nM thapsigargin [Tg]) for 12 h. For DTT treatment, transfected cells were exposed to 2 mM DTT for 2 h and then incubated with DTT-free fresh medium for 10 h. At 36 h post transfection, cells were washed with phosphate-buffered saline (PBS) three times, harvested, and stored at ?80°C for dual luciferase assay. Dual-Luciferase? assay (Promega) was carried out as described previously (Back et al., 2006). Firefly luciferase activity was normalized against
For firefly luciferase assay in double stable cell lines expressing GV- hATF6αΔN(aa 333?670), cells were plated onto 48-well culture dishes the day before treatment. These cells were treated with different amounts of ER stress inducers (Tm or Tg) for 12 h or specified amounts of ER stress inducers (1 μg Tm or 5 nM Tg) for indicated times. For DTT treatment, cells were exposed to different amounts of DTT or specified amount (2 mM DTT) for 2 h and then incubated with DTT-free fresh medium for indicated times. After treatment, cells were washed with PBS three times, harvested, and stored at ?80°C for firefly luciferase assay. Luciferase assay (Promega) was carried out according to the manufacturer’s instructions. Firefly luciferase activities were normalized to protein contents (relative light units per microgram of protein).
HLR-GV-hATF6α(333) cells, but not HLR cells, were treated with 2 mM DTT for 2 h and then incubated with DTT-free fresh medium for indicated times. HLR-GV-hATF6α(333) cells were treated with or without 1 μg/ml Tm or 5 nM Tg for 12 h, respectively. For DTT treatment, cells were exposed to 2 mM DTT for 2 h and then incubated with DTT-free fresh medium for 10 h. Cell lysates were prepared from HLR cells or ER stress inducer-treated HLR-GV-hATF6α(333) cells using EzRIPA lysis kit (20 mM HEPES pH 7.5, 150 mM NaCl, 1% IGEPAL CA-630, 0.1% SDS, 0.5% sodium deoxycholate) including 1× protease inhibitors (aprotinin, pepstatin A, and leupeptin) and 1× phosphatase inhibitors (sodium fluoride, sodium vanadate, and sodium glycerophosphate) as specified by the manufacturer (ATTO, USA). Cell lysates were centrifuged at 13,000
To obtain nuclear and cytosolic fractions from HLR or HLR-GV-hATF6α(333) cells treated with or without three ER stress inducers, cell pellets were resuspended in 350 μl 1× hypotonic buffer (10 mM HEPES pH 7.4, 10 mM KCl, 0.1 mM EDTA, 0.5% NP-40, 1 mM DTT, protease inhibitor cocktail, and phosphatase inhibitor cocktail) by passing cell suspension through 20-gauge needle 15 to 20 times. Homogenates were incubated on ice for 40 min. During incubation, homogenates were vortexed for 20 seconds at the highest setting every 10 min. Samples were then centrifuged at 15,700
For fluorescence microscopy, HLR-GV-hATF6α(333) cells were grown on 1% gelatin-coated coverslips. The cells were exposed to 2 mM DTT for 2 h and then incubated with DTT-free fresh medium for 4 h. Next, cells were washed with PBS three times and then fixed with 4% (w/v) paraformaldehyde (Sigma-Aldrich) at room temperature for 15 min. After washing with PBS three times, cells on coverslips were permeabilized in 0.1% Triton X-100 at room temperature for 2 min and washed with PBS three times. For GAL4DBD immunostaining, samples were blocked in a blocking solution (PBS containing 3% bovine serum albumin) for 1 h at room temperature and then incubated with anti-GAL4 antibody (Santa Cruz Biotechnology) at 4°C overnight. After washing with PBS three times, samples were treated with Hoechst 33342 at room temperature for 2 min and washed again with PBS three times. They were then incubated with rhodamine (tetramethyl rhodamine isothiocyanate [TRITC])-conjugated goat anti-mouse IgG (Jackson ImmunoResearch Laboratories, USA) at room temperature for 1 h. Finally, these coverslips were washed three times with PBS, placed on glass slides, and sealed with transparent nail polish. Images were captured with a cooled charge-coupled device camera and a confocal laser scanning microscope (FLUOVIEW FV10i; Olympus, Japan).
We determined the C-terminal minimal domain required by the ATF6α N-terminal deletion variant fused to a trans-activator protein (GAL4DBD-VP16AD, GV) consisting of the GAL4DBD and the VP16AD. Toward this end, we constructed six vectors expressing a fusion trans-activator protein (GV) followed by full-length or various N-terminal-deleted variants of human ATF6α (GV-hATF6α or GV-hATF6αΔNs; Figs. 1A and 1B). Resulting vectors were co-transfected into HLR cells, which carries a stably integrated firefly luciferase reporter gene, with
Through Dual-Luciferase? Reporter (DLRTM) assay, the ratio of firefly luciferase to
In Tm-treated HLR cells, no significant fold inductions were detected following the expression of Full: GV-hATF6α(1?670), 93: GV-hATF6αΔN(93?670), 307: GV-hATF6αΔN(307?670) and 374: GV-hATF6αΔN(374?670) deletion variants. Therefore, the four constructs were not selected for further studies. Next, among the remaining two constructs, the 333: GV-hATF6αΔN(333?670) deletion variant expressing HLR cells always showed higher luciferase activities than the 362: GV-hATF6αΔN(362?670) expressing HLR cells. Nevertheless, the former had a smaller fold induction than the latter because of strong basal firefly luciferase activity without treatments. Based on the constitutive proteolysis observed in overexpressed GAL4DBD-ATF6α (Chen et al., 2002) or full-length ATF6 (Haze et al., 1999; Yoshida et al., 1998), the highly basal firefly luciferase activity was induced by such proteolysis of 333: GV-hATF6αΔN(333?670) overexpressed in transfected cells. However, if the deletion variant is expressed at a lower level when 333: GV-hATF6αΔN(333?670)-expressing HLR stable cell lines are generated, the constitutively activated proteolysis of 333: GV-hATF6αΔN(333?670) may be decreased and the basal firefly luciferase activity may be lowered, resulting in higher fold induction under ER stress. Based on this rationale, the 333: GV-hATF6αΔN(333?670)-expressing construct was selected to generate double stable luciferase reporter cell lines to monitor RIP of ATF6α.
To generate a double stable reporter cell line expressing firefly luciferase by regulated proteolysis of GV-hATF6αΔN(aa 333?670) chimeric protein, HLR cells were transfected with Ssp1-digested DNA fragment of pCMV-GV-hATF6αΔN(aa 333?670) vector encoding a fusion trans-activator protein (GAL4DBD-VP16AD) followed by N-terminal deleted variant (aa 333?670) of hATF6α (Figs. 2A and 2B). These transfected cells were selected using medium containing both G418 for GV-hATF6αΔN(aa 333?670) expressing cassette (Fig. 2A) and hygromycin B for firefly luciferase expressing cassette. After generation of double stable cell lines, the ability of the reporter cell line to monitor intramembrane proteolysis-dependent ATF6α activation was evaluated based on increased firefly luciferase activity under DDT treatment (Fig. 2C). Of 10 G418 and hygromycin B resistant clones, two clones showed ~30 folds (clone #3) or ~50 folds (clone #6) induction in firefly luciferase activity upon treatment with DTT, respectively. Because clone #3 showed the highest relative luciferase activity, this clone was chosen for further characterization and named HLR-GV-hATF6α(333) cell line.
To check the ability of HLR-GV-hATF6α(333) reporter cell line in response to ER stress, luciferase activities of HLR-GV-hATF6α(333) cells were measured after treatment with DDT, Tm, and Tg at different concentrations or times. Concentrations that showed the maximal luciferase activities were found to be 2 mM for DTT, 1 mM for Tm, and 5 nM for Tg (Figs. 3A?3C). Higher concentrations did not further increase luciferase activity. Next, the best treatment time of each ER stress inducer was determined at these concentrations selected based on results from Figures 3A?3C. Significant increase of luciferase activity was detected after treatment with DDT for 2 h. The maximal luciferase activity was detected after treatment with DDT for 12 h, Tm for 18 h, or Tg for 12 h (Figs. 3D?3F). However, the maximal activity did not sustain after further incubation. Next, to confirm that HLR-GV-hATF6α(333) cell line expressed GV-hATF6αΔN(aa 333?670) fusion protein and ER stress could induce its proteolysis to generate GV-hATF6αΔNΔC(aa 333?380) fragment, Western blot analysis was performed using GAL4 antibody and each ER stress inducer-treated cell lysate (Figs. 3G and 3H). HLR-GV-hATF6α(333) cells constitutively expressed ~75 kDa GV-hATF6αΔN(aa 333?670) protein while the original HLR cells did not (Fig. 3G; lanes 1 and 2). However, DDT treatment immediately made the full length GV-hATF6αΔN(aa 333?670) disappear till 4 h after treatment (lanes 3 and 4). Simultaneously, ~40 kDa small cleaved products supposed to be GV-hATF6αΔNΔC(aa 333?380) fragments were detected till 18 h (lanes 3 to 6). As described for DTT treatment experiments in Materials and Methods section, DDT-free media replaced DDT-containing media after 2 h of treatment. Therefore, it was believed that DDT effect diminished and cells recovered from ER stress as time went by, resulting in reduction of GV-hATF6αΔNΔC(aa 333?380) fragments and appearance of full length GV-hATF6αΔN(aa 333?670) proteins (Fig. 3G; lanes 5?8). Moreover, RIP of GV-hATF6αΔN(aa 333?670) was also observed in Tm or Tg-treated cell lysate (Fig. 3H). Importantly, GV-hATF6αΔNΔC(aa 333?380) fragments generated by RIP were detected in only ER stress inducer-treated cell lysates, but not in mock-treated cell lysate (Figs. 3G; lane 2 and 3H; lane 1), indicating that GV-hATF6αΔN(aa 333?670) expressing HLR-GV-hATF6α(333) cell line could be utilized as a specific and novel reporter cell line for measuring RIP of ATF6α.
As described our reporter system in the introduction part, the GV-hATF6αΔNΔC(aa 333?380) fragment working as a transcription factor should translocate into the nucleus to induce expression of firefly luciferase gene in HLR-GV-hATF6α(333) cell line during ER stress. To assess nuclear localization of the chimeric fragment, immunofluorescence analysis was performed using GAL4 antibody and DTT-treated cells (Fig. 4A). Without DTT treatment, majority of anti-GAL4 reactive proteins were localized in the cytosol (Fig. 4A; upper panels). However, with DTT treatment, most anti-GAL4 reactive proteins were observed in the nucleus of HLR-GV-hATF6α(333) cells (Fig. 4A; lower panels), suggesting that the GAL4DBD-containing cleavage fragment of GV-hATF6αΔN(aa 333?670) believed to be GAL4DBD-VP16AD(GV)-ATF6αΔNΔC(aa 333?380) fragment was generated after DTT treatment. It then translocated into the nucleus. Next, we further confirmed nuclear localization of GV-ATF6αΔNΔC(aa 333?380) fragment by subcellular fractionation. Cytosolic and nuclear fractions were extracted from original HLR cells and ER stress inducer-treated HLR-GV-hATF6α(333) cells. Western blot analysis of “house-keeper” (HK) proteins (α-tubulin and histone H3 for cytosolic and nuclear fractions, respectively) validated the purity of fractionated samples (Fig. 4B). In Western blot analysis of fractionated samples of HLR cells, there was no anti-GAL4 specific band in either fraction (lanes 1 and 6). Before ER stress inducer treatment, the GV-ATF6αΔNΔC(aa 333?380) fragment was virtually undetectable in the nuclear fraction of HLR-GV-hATF6α(333) cells (lane 7). Instead, full length GV-hATF6αΔN(aa 333?670) proteins were only detected in the cytosolic fraction of HLR-GV-hATF6α(333) cells (lane 2). However, GV-ATF6αΔNΔC(aa 333?380) fragments were clearly observed in nuclear factions of ER stress inducer (DTT, Tm, or Tg)-treated HLR-GV-hATF6α(333) cells (lanes 8?10), indicating that HLR-GV-hATF6α(333) cell lines could produce nuclear localized anti-GAL4 reactive protein as a transcription factor to induce expression of firefly luciferase gene under ER stress conditions.
In this report, we developed a specific, rapid, and convenient monitoring system for the
Compared with other known reporter systems, the RIP reporter system is unique. It is distinct from other UPRE or ERSE element-based reporter systems (Gallagher et al., 2016; Lee et al., 2002; Wang et al., 2000; Yoshida et al., 1998) in that the transcription of luciferase is not induced by endogenous transcription factors (such as XBP1s or activated ATF6β) generated upon ATF6α activation, but is solely dependent on the translocation of GAL4DBD-VP16AD-ATF6αΔN to the Golgi followed by the cleavage of transmembrane domain under specific conditions. Therefore, our RIP reporter system is not only a unique tool to monitor RIP of ATF6α, but also represents a substitute for other nonspecific reporter systems that use an UPRE- or ERSE-based luciferase reporter (Gallagher et al., 2016; Lee et al., 2002; Wang et al., 2000; Yoshida et al., 1998). Furthermore, compared with GAL4DBD full-length ATF6α fusion protein reported by Ron Prywes’s group before (Chen et al., 2002; Wang et al., 2000), our GV-ATF6αΔN(aa 333?670) does not carry most functional domains of ATF6α N-terminal active transcription factor fragment (pATF6(N)). The active pATF6(N) fragment generated from full-length ATF6α interacts with other transcription factors (such as serum response factor [SRF] or spliced XBP1) (Yamamoto et al., 2007; Zhu et al., 1997). The pATF6(N)/SRF or pATF6(N)/XBP1s heterodimer complexes cooperatively lead to induce expression of several serum- or ER stress-dependent genes, respectively. Hence, the active GAL4DBD-pATF6(N) fragment generated from GAL4DBD-full length ATF6α can also form a heterodimer complex, which may affect the expression of various endogenous target genes. Consequently, a reporter cell line additionally expressing the active GAL4DBD-pATF6(N) fragment may show different cellular response compared to a normal cell line, and in turn the results of the reporter cell line may be distorted by exogenous and active GAL4DBD-pATF6(N) fragment. However, our GV-ATF6αΔN(aa 333?670) may not show the binding ability or transcriptional activity, which affect the expression of endogenous serum- or ER stress-dependent genes. Thus, we believe that our RIP reporter system represents a specific and reliable experimental tool to monitor RIP of ATF6α.
Therefore, this reporter system can be used to screen for genes, small-molecules, and protein-based drugs that can activate or inhibit RIP of ATF6α. Moreover, for other known transmembrane bZIP transcription factors including Luman/CREB3, OASIS/CREB3L1, BBF2H7/CREB3L2, CREB-H/CREB3L3, CREB4/AIbZIP/CREB3L4, and CREBL1/ATF6β (Bailey and O’Hare, 2007), if the optimal DNA fragment for cleavage of GAL4DBD-VP16AD(GV)-bZIP transcription factor is determined as shown in the present study, the resulting plasmid can be used to develop a new reporter system for monitoring RIP of the transmembrane bZIP transcription factor in the luciferase reporter cell line which contains a stably integrated 5X GAL4 site-luciferase gene.
We thank Mi-Jeong Kim and Kyung-Ju Ahn at University of Ulsan for technical assistance with data preparation. This research was supported by a grant (2017R1D1A1B03035248 to J.Y.M.) of the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education. This research was also supported by the Priority Research Centers Program (2014R1A6A1030318 to S.H.B.) and the Bio & Medical Technology Development Program (2017M3A9G7072745 to S.H.B.) of the NRF funded by the Korean government. Portions of this work were supported by National Institutes of Health (NIH) grants (CA198103, DK113171 and AG062190 to R.J.K.).
Mol. Cells 2019; 42(11): 783-793
Published online November 30, 2019 https://doi.org/10.14348/molcells.2019.0104
Copyright © The Korean Society for Molecular and Cellular Biology.
Jin-Ik Kim1, Randal J. Kaufman2, Sung Hoon Back3,*, and Ja-Young Moon1,*
1Department of Biochemistry & Health Sciences, Changwon National University, Changwon 51140, Korea, 2Degenerative Diseases Program, Sanford Burnham Prebys Medical Discovery Institute, La Jolla, CA 92037, USA, 3School of Biological Sciences, University of Ulsan, Ulsan 44610, Korea
Correspondence to:shback@ulsan.ac.kr (SHB); jymoon@changwon.ac.kr (JYM)
This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/3.0/.
When endoplasmic reticulum (ER) functions are perturbed, the ER induces several signaling pathways called unfolded protein response to reestablish ER homeostasis through three ER transmembrane proteins: inositol-requiring enzyme 1 (IRE1), PKR-like ER kinase (PERK), and activating transcription factor 6 (ATF6). Although it is important to measure the activity of ATF6 that can indicate the status of the ER, no specific cell-based reporter assay is currently available. Here, we report a new cell-based method for monitoring ER stress based on the cleavage of ATF6α by sequential actions of proteases at the Golgi apparatus during ER stress. A new expressing vector was constructed by using fusion gene of GAL4 DNA binding domain (GAL4DBD) and activation domain derived from herpes simplex virus VP16 protein (VP16AD) followed by a human ATF6α N-terminal deletion variant. During ER stress, the GAL4DBD-VP16AD(GV)-hATF6α deletion variant was cleaved to liberate active transcription activator encompassing GV-hATF6α fragment which could translocate into the nucleus. The translocated GV-hATF6α fragment strongly induced the expression of firefly luciferase in HeLa Luciferase Reporter cell line containing a stably integrated 5X GAL4 site-luciferase gene. The established double stable reporter cell line HLR-GV-hATF6α(333) represents an innovative tool to investigate regulated intramembrane proteolysis of ATF6α. It can substitute active pATF6(N) binding motif-based reporter cell lines.
Keywords: activating transcription factor 6, ER stress, GAL4 binding site, luciferase, regulated intramembrane proteolysis, reporter cell line, unfolded protein response
The endoplasmic reticulum (ER) is a specialized cell organelle that plays important roles in the biosynthesis of many membrane proteins and secreted proteins, their posttranslational modifications (assembly, glycosylation, and disulfide bond), calcium storage and gated release, and production of lipids and sterols. When ER functions are perturbed, the ER induces several signaling pathways called unfolded protein response (UPR) to reestablish ER homeostasis (Back and Kaufman, 2012; Ron and Walter, 2007; Wang and Kaufman, 2016).
In UPR, three ER transmembrane proteins, inositol-requiring enzyme 1 (IRE1), PKR-like ER kinase (PERK, EIF2AK3), and activating transcription factor 6 (ATF6), serve as proximal transducers of UPR pathways (Hetz et al., 2011; Ron and Walter, 2007; Rutkowski and Kaufman, 2007; Wek and Cavener, 2007). IRE1 has ER-stress regulated kinase and endonuclease activities that can initiate unconventional splicing of mRNA encoding basic leucine zipper transcription factor X-box binding protein 1 (XBP1) (Hetz and Glimcher, 2009). IRE1-mediated unconventional cytoplasmic splicing removes a 26-nucleotide intron from unspliced Xbp1 mRNA to induce a translational frameshift, producing a fusion protein encoded from two evolutionarily conserved open reading frames (Ron and Walter, 2007). The fusion protein, XBP1s, acts as a potent transcription factor that can activate the expression of UPR target genes involved in protein folding and export from the ER, export and degradation of misfolded proteins, and lipid biosynthesis to resolve ER stress (Back and Kaufman, 2012; Ron and Walter, 2007). Therefore, measurement or observation of the extent of Xbp1 mRNA splicing is a good tool for monitoring IRE1 activation under ER stress condition. Several studies (Back et al., 2006; Iwawaki et al., 2004; Spiotto et al., 2010) have developed reporter systems for monitoring IRE1-mediated Xbp1 mRNA splicing, a partial sequence of Xbp1, including 26-nt ER stress-specific intron fused to the gene encoding firefly luciferase (FLuc) or green fluorescence protein (GFP). During stress, the spliced indicator mRNA is translated into an XBP1ΔC-Fluc or GFP fusion protein that can be detected by its luminescence or fluorescence.
Activated PERK can phosphorylate serine 51 on the α-subunit of heterotrimeric eukaryotic translation initiation factor 2 (eIF2) (Proud, 2005). Phosphorylation of eIF2α in eIF2 complex results in global attenuation of general mRNA translation while simultaneously enhancing the translation of selected mRNAs (such as activating transcription factor 4 [Atf4] mRNA) that contain short upstream open reading frames in their 5′ untranslated regions (5′UTRs) (Pakos-Zebrucka et al., 2016; Wek et al., 2006). Therefore, under ER stress condition, measurement of Atf4 5′UTR-dependet translational activity is a useful tool for monitoring the status of eIF2α phosphorylation. A reporter construct consisting of translational fusions of the Atf4 5′UTR and the luciferase coding region has been reported (Harding et al., 2000). Recently, a transgenic mouse model for monitoring translational activation of ATF4 in response to cellular stress has been developed (Iwawaki et al., 2017). However, in mammalian cells, there are three more eIF2α kinases (general control nonderepressible 2 [GCN2], protein kinase RNA-activated [PKR], and heme-regulated inhibitor kinase [HRI]) that can be activated by distinct stress stimuli (Pakos-Zebrucka et al., 2016; Wek et al., 2006), suggesting that Atf4 5′UTR-mediated translation enhancement does not always represent activation of PERK-dependent eIF2α phosphorylation pathway.
ATF6 is the third proximal transducer of UPR pathways that is encoded by two related genes, Atf6α and Atf6β (Yoshida et al., 1998). The C-terminal of ATF6 protrudes into the ER lumen whereas its N-terminal faces the cytosol. The N-terminal cytosolic part encompasses a transactivation domain and a basic leucine zipper region followed by a 20-amino acid transmembrane domain (Haze et al., 1999). Under normal conditions, the ER luminal domain of ATF6 maintains ATF6 in an inactive state by binding to BiP, a major molecular chaperone in the ER. Upon ER stress, BiP dissociation from the ER luminal domain of ATF6 exposes Golgi localization signals, evoking ATF6 translocation to the Golgi apparatus (Shen et al., 2002). In addition, ER stress can reduce the extent of intra- and inter-molecular disulfide bridges formed between the two conserved cysteine residues in the luminal domain (Nadanaka et al., 2007). These two molecular mechanisms can induce translocated ATF6 proteins to be cleaved by sequential actions of site 1 protease (S1P) and site 2 protease (S2P) at the Golgi apparatus (Shen and Prywes, 2004; Ye et al., 2000), resulting in liberation of a soluble and active transcription factor designated pATF6(N) (Yoshida et al., 2000; 2001). Thus, activation of ATF6 is characterized as one regulated intramembrane proteolysis (RIP). Liberated pATF6(N) transcription factor can enter the nucleus and bind to ER stress-response elements (ERSEs) of genes that encode functions in ER protein folding, endoplasmic reticulum-associated degradation (ERAD), protein secretion, and ER biogenesis (Back and Kaufman, 2012; Yoshida, 2007). Therefore, measurement of ATF6 activation can be another tool for monitoring ER stress. The most commonly utilized assay systems for monitoring ATF6α activation are luciferase reporter constructs driven by tandem copies of either a UPR element (UPRE) (Lee et al., 2002; Wang et al., 2000) or by BiP promoter which contains three ERSE sites (Gallagher et al., 2016; Yoshida et al., 1998). However, both UPRE and ERSE element sequences of these reporter constructs are a consensus DNA binding motif for other transcription factors such as spliced XBP1 or activated ATF6β that can be generated during ER stress (Bommiasamy et al., 2009; Lee et al., 2003; Yamamoto et al., 2007). Therefore, under ER stress, UPRE or BiP promoter-driven luciferase expression can occur by binding of not only activated ATF6α and β but also spliced XBP1 in cell-based assays using these reporter constructs, suggesting that such promoter-based reporter assay will not solely represent activation of ATF6α during ET stress. On the other hand, previous studies (Chen et al., 2002; Wang et al., 2000) have reported that full length ATF6α fused to GAL4 DNA binding domain (GAL4DBD) could activate 5X GAL4 site-luciferase reporter under ER stress. However, it was difficult to detect GAL4DBD-ATF6α protein in immunoblots using SV40 promoter (Wang et al., 2000). In addition, the expression of GAL4DBD-ATF6α protein should be regulated at low level to prevent activation of reporter gene in uninduced cells (Chen et al., 2002). As such, the development of a reporter cell line for monitoring activation of ATF6α under ER stress conditions has not been reported yet.
Thus, the objective of this study was to develop a luciferase reporter cell line that could monitor activation of ATF6α under ER stress conditions. We constructed a new expressing vector using fusion gene of GAL4DBD and activation domain derived from herpes simplex virus VP16 protein (VP16AD) followed by a human ATF6α N-terminal deletion variant that could generate a cytosolic and active transcription activator (encompassing GAL4DBD-VP16AD and cytosolic part of hATF6α) by S1P and S2P-mediated ATF6α cleavage under ER stress conditions. The GAL4DBD-VP16AD(GV)-hATF6α deletion variant expressing construct was stably integrated into HeLa Luciferase Reporter (HLR) cell line containing a stably integrated 5X GAL4 site-luciferase gene. The expressed GAL4DBD-VP16AD(GV)-hATF6α deletion variant was efficiently cleaved in the established double stable reporter cell line in response to ER stress inducers. The active transcription factor encompassing GAL4DBD-VP16AD and cytosolic part of hATF6α can translocate into the nucleus and strongly induce the expression of firefly luciferase gene in the HLR cell line.
pCMV-GAL4DBD-VP16AD-hATF6α full or deletion variants were generated by inserting coding sequences that could express a fusion protein of the GAL4 DNA binding domain (GAL4DBD, amino acids 1?147) and the VP16AD (amino acids 413?490) followed by human ATF6α full length or deletion variants into pcDNA 3.1(+) vector (Invitrogen, USA). The coding sequence fragment of GAL4DBD-VP16AD was amplified from pM3-VP16 vector (Clontech Laboratories, USA) by polymerase chain reaction (PCR) with the following primers: 5′-GGGTTTGCTAGCTTCCTGAAAGATGAAG-3′ and 5′-GGGTTTGATATCCCCACCGTACTCGTCAATTC-3′. cDNAs of human ATF6α full length or deletion variants were obtained from pCGNATF6α full length (Zhu et al., 1997) generously provided by Dr. Ron Prywes (Columbia University, USA) by PCR with the following pairs. Forward primers included hATF6α (full, aa 1?670), 5′-GGGTTTGATATCATGGGGGAGCCGGCTGGGGTTG-3′; hATF6α (aa 93?670), 5′-GGGTTTGATATCCTTCCAGCCTCCTCAAGTTAT-3′; hATF6α (aa 307?670), 5′-GGGTTTGATATCCTAAGGAGACAGCAACGTATGAT-3′; hATF6α (aa 333?670), 5′-GGGTTTGATATCGGGTTAGAGGCGAGATTAAAGGC-3′; hATF6α (aa 362?670), 5′-GGGTTTGATATCGTTGTGTCAGAGAACCAGAG-3′; and hATF6α (aa 374?670): 5′-GGGTTTGATATCCTAAGGAGACAGCAACGTAT-3′. Common reverse primer was 5′-GGGTTTGCGGCCGCCTAAGCGTAATCTGGAACATCGTATGGGTATTGTAATG ACTCAGGGATGG-3′.
To construct pCMV-GAL4DBD-VP16AD-hATF6α full or deletion variants, pCMV-GAL4DBD-VP16AD was generated at first. GAL4DBD-VP16AD PCR fragment digested with NheI and EcoRV restriction enzymes was inserted into pcDNA 3.1(+) vector (Invitrogen) digested with the same restriction endonucleases. Next, pCMV-GAL4DBD-VP16AD-hATF6α full or deletion variants were constructed by inserting hATF6α full or deletion variants’ PCR fragments digested with EcoRV and NotI into pCMV-GAL4DBD-VP16AD plasmid treated with the same restriction enzymes. Clones were confirmed by sequencing.
HLR cells (Agilent Technologies, USA) containing a stably integrated 5X GAL4 binding site of luciferase reporter gene were grown in Dulbecco’s modified Eagle’s medium (Invitrogen) supplemented with 10% fetal bovine serum (Hyclone, USA), 1% glutamax (Invitrogen), 1% penicillin G/streptomycin (Invitrogen), and 0.1 mg/ml of Hygromycin B (Invitrogen).
To generate stably transformed HLR cells expressing GAL4DBD-VP16AD-hATF6αΔN(aa 333?670) under the control of CMV enhancer-promoter, HLR cells were transfected with SspI-digested pCMV-GAL4DBD-VP16AD-hATF6αΔN(aa 333?670) vector. Transformants were selected with both hygromycin B (0.1 mg/ml) and G418 (0.5 mg/ml) antibiotics. Antibiotics-resistant stable cell clones were screened for the activity of firefly luciferase after treatment with dithiothreitol (DTT, 2 mM) as an ER stress inducer as described below. Among several positive clones identified, one clone (#3) that showed the highest firefly luciferase activity after DTT treatment was chosen. Thus, in subsequent experiments, we used a clone named HLR-GV-hATF6α(333) expressing GAL4DBD-VP16AD(GV)-hATF6αΔN(aa 333?670).
HLR cells were plated onto 48-well culture dishes the day before transfection. Expressing plasmids (0.5 μg of pcDNA3.1(+), pCMV-GAL4DBD-VP16AD-hATF6α full or deletion variants) and reference plasmid (0.01 μg of pRL-CMV; Promega, USA) were transfected into HLR cells using Fugene 6 (Promega) for 24 h. These cells were then further incubated with fresh medium with DMSO or ER stress inducers (1 μg tunicamycin [Tm] or 5 nM thapsigargin [Tg]) for 12 h. For DTT treatment, transfected cells were exposed to 2 mM DTT for 2 h and then incubated with DTT-free fresh medium for 10 h. At 36 h post transfection, cells were washed with phosphate-buffered saline (PBS) three times, harvested, and stored at ?80°C for dual luciferase assay. Dual-Luciferase? assay (Promega) was carried out as described previously (Back et al., 2006). Firefly luciferase activity was normalized against
For firefly luciferase assay in double stable cell lines expressing GV- hATF6αΔN(aa 333?670), cells were plated onto 48-well culture dishes the day before treatment. These cells were treated with different amounts of ER stress inducers (Tm or Tg) for 12 h or specified amounts of ER stress inducers (1 μg Tm or 5 nM Tg) for indicated times. For DTT treatment, cells were exposed to different amounts of DTT or specified amount (2 mM DTT) for 2 h and then incubated with DTT-free fresh medium for indicated times. After treatment, cells were washed with PBS three times, harvested, and stored at ?80°C for firefly luciferase assay. Luciferase assay (Promega) was carried out according to the manufacturer’s instructions. Firefly luciferase activities were normalized to protein contents (relative light units per microgram of protein).
HLR-GV-hATF6α(333) cells, but not HLR cells, were treated with 2 mM DTT for 2 h and then incubated with DTT-free fresh medium for indicated times. HLR-GV-hATF6α(333) cells were treated with or without 1 μg/ml Tm or 5 nM Tg for 12 h, respectively. For DTT treatment, cells were exposed to 2 mM DTT for 2 h and then incubated with DTT-free fresh medium for 10 h. Cell lysates were prepared from HLR cells or ER stress inducer-treated HLR-GV-hATF6α(333) cells using EzRIPA lysis kit (20 mM HEPES pH 7.5, 150 mM NaCl, 1% IGEPAL CA-630, 0.1% SDS, 0.5% sodium deoxycholate) including 1× protease inhibitors (aprotinin, pepstatin A, and leupeptin) and 1× phosphatase inhibitors (sodium fluoride, sodium vanadate, and sodium glycerophosphate) as specified by the manufacturer (ATTO, USA). Cell lysates were centrifuged at 13,000
To obtain nuclear and cytosolic fractions from HLR or HLR-GV-hATF6α(333) cells treated with or without three ER stress inducers, cell pellets were resuspended in 350 μl 1× hypotonic buffer (10 mM HEPES pH 7.4, 10 mM KCl, 0.1 mM EDTA, 0.5% NP-40, 1 mM DTT, protease inhibitor cocktail, and phosphatase inhibitor cocktail) by passing cell suspension through 20-gauge needle 15 to 20 times. Homogenates were incubated on ice for 40 min. During incubation, homogenates were vortexed for 20 seconds at the highest setting every 10 min. Samples were then centrifuged at 15,700
For fluorescence microscopy, HLR-GV-hATF6α(333) cells were grown on 1% gelatin-coated coverslips. The cells were exposed to 2 mM DTT for 2 h and then incubated with DTT-free fresh medium for 4 h. Next, cells were washed with PBS three times and then fixed with 4% (w/v) paraformaldehyde (Sigma-Aldrich) at room temperature for 15 min. After washing with PBS three times, cells on coverslips were permeabilized in 0.1% Triton X-100 at room temperature for 2 min and washed with PBS three times. For GAL4DBD immunostaining, samples were blocked in a blocking solution (PBS containing 3% bovine serum albumin) for 1 h at room temperature and then incubated with anti-GAL4 antibody (Santa Cruz Biotechnology) at 4°C overnight. After washing with PBS three times, samples were treated with Hoechst 33342 at room temperature for 2 min and washed again with PBS three times. They were then incubated with rhodamine (tetramethyl rhodamine isothiocyanate [TRITC])-conjugated goat anti-mouse IgG (Jackson ImmunoResearch Laboratories, USA) at room temperature for 1 h. Finally, these coverslips were washed three times with PBS, placed on glass slides, and sealed with transparent nail polish. Images were captured with a cooled charge-coupled device camera and a confocal laser scanning microscope (FLUOVIEW FV10i; Olympus, Japan).
We determined the C-terminal minimal domain required by the ATF6α N-terminal deletion variant fused to a trans-activator protein (GAL4DBD-VP16AD, GV) consisting of the GAL4DBD and the VP16AD. Toward this end, we constructed six vectors expressing a fusion trans-activator protein (GV) followed by full-length or various N-terminal-deleted variants of human ATF6α (GV-hATF6α or GV-hATF6αΔNs; Figs. 1A and 1B). Resulting vectors were co-transfected into HLR cells, which carries a stably integrated firefly luciferase reporter gene, with
Through Dual-Luciferase? Reporter (DLRTM) assay, the ratio of firefly luciferase to
In Tm-treated HLR cells, no significant fold inductions were detected following the expression of Full: GV-hATF6α(1?670), 93: GV-hATF6αΔN(93?670), 307: GV-hATF6αΔN(307?670) and 374: GV-hATF6αΔN(374?670) deletion variants. Therefore, the four constructs were not selected for further studies. Next, among the remaining two constructs, the 333: GV-hATF6αΔN(333?670) deletion variant expressing HLR cells always showed higher luciferase activities than the 362: GV-hATF6αΔN(362?670) expressing HLR cells. Nevertheless, the former had a smaller fold induction than the latter because of strong basal firefly luciferase activity without treatments. Based on the constitutive proteolysis observed in overexpressed GAL4DBD-ATF6α (Chen et al., 2002) or full-length ATF6 (Haze et al., 1999; Yoshida et al., 1998), the highly basal firefly luciferase activity was induced by such proteolysis of 333: GV-hATF6αΔN(333?670) overexpressed in transfected cells. However, if the deletion variant is expressed at a lower level when 333: GV-hATF6αΔN(333?670)-expressing HLR stable cell lines are generated, the constitutively activated proteolysis of 333: GV-hATF6αΔN(333?670) may be decreased and the basal firefly luciferase activity may be lowered, resulting in higher fold induction under ER stress. Based on this rationale, the 333: GV-hATF6αΔN(333?670)-expressing construct was selected to generate double stable luciferase reporter cell lines to monitor RIP of ATF6α.
To generate a double stable reporter cell line expressing firefly luciferase by regulated proteolysis of GV-hATF6αΔN(aa 333?670) chimeric protein, HLR cells were transfected with Ssp1-digested DNA fragment of pCMV-GV-hATF6αΔN(aa 333?670) vector encoding a fusion trans-activator protein (GAL4DBD-VP16AD) followed by N-terminal deleted variant (aa 333?670) of hATF6α (Figs. 2A and 2B). These transfected cells were selected using medium containing both G418 for GV-hATF6αΔN(aa 333?670) expressing cassette (Fig. 2A) and hygromycin B for firefly luciferase expressing cassette. After generation of double stable cell lines, the ability of the reporter cell line to monitor intramembrane proteolysis-dependent ATF6α activation was evaluated based on increased firefly luciferase activity under DDT treatment (Fig. 2C). Of 10 G418 and hygromycin B resistant clones, two clones showed ~30 folds (clone #3) or ~50 folds (clone #6) induction in firefly luciferase activity upon treatment with DTT, respectively. Because clone #3 showed the highest relative luciferase activity, this clone was chosen for further characterization and named HLR-GV-hATF6α(333) cell line.
To check the ability of HLR-GV-hATF6α(333) reporter cell line in response to ER stress, luciferase activities of HLR-GV-hATF6α(333) cells were measured after treatment with DDT, Tm, and Tg at different concentrations or times. Concentrations that showed the maximal luciferase activities were found to be 2 mM for DTT, 1 mM for Tm, and 5 nM for Tg (Figs. 3A?3C). Higher concentrations did not further increase luciferase activity. Next, the best treatment time of each ER stress inducer was determined at these concentrations selected based on results from Figures 3A?3C. Significant increase of luciferase activity was detected after treatment with DDT for 2 h. The maximal luciferase activity was detected after treatment with DDT for 12 h, Tm for 18 h, or Tg for 12 h (Figs. 3D?3F). However, the maximal activity did not sustain after further incubation. Next, to confirm that HLR-GV-hATF6α(333) cell line expressed GV-hATF6αΔN(aa 333?670) fusion protein and ER stress could induce its proteolysis to generate GV-hATF6αΔNΔC(aa 333?380) fragment, Western blot analysis was performed using GAL4 antibody and each ER stress inducer-treated cell lysate (Figs. 3G and 3H). HLR-GV-hATF6α(333) cells constitutively expressed ~75 kDa GV-hATF6αΔN(aa 333?670) protein while the original HLR cells did not (Fig. 3G; lanes 1 and 2). However, DDT treatment immediately made the full length GV-hATF6αΔN(aa 333?670) disappear till 4 h after treatment (lanes 3 and 4). Simultaneously, ~40 kDa small cleaved products supposed to be GV-hATF6αΔNΔC(aa 333?380) fragments were detected till 18 h (lanes 3 to 6). As described for DTT treatment experiments in Materials and Methods section, DDT-free media replaced DDT-containing media after 2 h of treatment. Therefore, it was believed that DDT effect diminished and cells recovered from ER stress as time went by, resulting in reduction of GV-hATF6αΔNΔC(aa 333?380) fragments and appearance of full length GV-hATF6αΔN(aa 333?670) proteins (Fig. 3G; lanes 5?8). Moreover, RIP of GV-hATF6αΔN(aa 333?670) was also observed in Tm or Tg-treated cell lysate (Fig. 3H). Importantly, GV-hATF6αΔNΔC(aa 333?380) fragments generated by RIP were detected in only ER stress inducer-treated cell lysates, but not in mock-treated cell lysate (Figs. 3G; lane 2 and 3H; lane 1), indicating that GV-hATF6αΔN(aa 333?670) expressing HLR-GV-hATF6α(333) cell line could be utilized as a specific and novel reporter cell line for measuring RIP of ATF6α.
As described our reporter system in the introduction part, the GV-hATF6αΔNΔC(aa 333?380) fragment working as a transcription factor should translocate into the nucleus to induce expression of firefly luciferase gene in HLR-GV-hATF6α(333) cell line during ER stress. To assess nuclear localization of the chimeric fragment, immunofluorescence analysis was performed using GAL4 antibody and DTT-treated cells (Fig. 4A). Without DTT treatment, majority of anti-GAL4 reactive proteins were localized in the cytosol (Fig. 4A; upper panels). However, with DTT treatment, most anti-GAL4 reactive proteins were observed in the nucleus of HLR-GV-hATF6α(333) cells (Fig. 4A; lower panels), suggesting that the GAL4DBD-containing cleavage fragment of GV-hATF6αΔN(aa 333?670) believed to be GAL4DBD-VP16AD(GV)-ATF6αΔNΔC(aa 333?380) fragment was generated after DTT treatment. It then translocated into the nucleus. Next, we further confirmed nuclear localization of GV-ATF6αΔNΔC(aa 333?380) fragment by subcellular fractionation. Cytosolic and nuclear fractions were extracted from original HLR cells and ER stress inducer-treated HLR-GV-hATF6α(333) cells. Western blot analysis of “house-keeper” (HK) proteins (α-tubulin and histone H3 for cytosolic and nuclear fractions, respectively) validated the purity of fractionated samples (Fig. 4B). In Western blot analysis of fractionated samples of HLR cells, there was no anti-GAL4 specific band in either fraction (lanes 1 and 6). Before ER stress inducer treatment, the GV-ATF6αΔNΔC(aa 333?380) fragment was virtually undetectable in the nuclear fraction of HLR-GV-hATF6α(333) cells (lane 7). Instead, full length GV-hATF6αΔN(aa 333?670) proteins were only detected in the cytosolic fraction of HLR-GV-hATF6α(333) cells (lane 2). However, GV-ATF6αΔNΔC(aa 333?380) fragments were clearly observed in nuclear factions of ER stress inducer (DTT, Tm, or Tg)-treated HLR-GV-hATF6α(333) cells (lanes 8?10), indicating that HLR-GV-hATF6α(333) cell lines could produce nuclear localized anti-GAL4 reactive protein as a transcription factor to induce expression of firefly luciferase gene under ER stress conditions.
In this report, we developed a specific, rapid, and convenient monitoring system for the
Compared with other known reporter systems, the RIP reporter system is unique. It is distinct from other UPRE or ERSE element-based reporter systems (Gallagher et al., 2016; Lee et al., 2002; Wang et al., 2000; Yoshida et al., 1998) in that the transcription of luciferase is not induced by endogenous transcription factors (such as XBP1s or activated ATF6β) generated upon ATF6α activation, but is solely dependent on the translocation of GAL4DBD-VP16AD-ATF6αΔN to the Golgi followed by the cleavage of transmembrane domain under specific conditions. Therefore, our RIP reporter system is not only a unique tool to monitor RIP of ATF6α, but also represents a substitute for other nonspecific reporter systems that use an UPRE- or ERSE-based luciferase reporter (Gallagher et al., 2016; Lee et al., 2002; Wang et al., 2000; Yoshida et al., 1998). Furthermore, compared with GAL4DBD full-length ATF6α fusion protein reported by Ron Prywes’s group before (Chen et al., 2002; Wang et al., 2000), our GV-ATF6αΔN(aa 333?670) does not carry most functional domains of ATF6α N-terminal active transcription factor fragment (pATF6(N)). The active pATF6(N) fragment generated from full-length ATF6α interacts with other transcription factors (such as serum response factor [SRF] or spliced XBP1) (Yamamoto et al., 2007; Zhu et al., 1997). The pATF6(N)/SRF or pATF6(N)/XBP1s heterodimer complexes cooperatively lead to induce expression of several serum- or ER stress-dependent genes, respectively. Hence, the active GAL4DBD-pATF6(N) fragment generated from GAL4DBD-full length ATF6α can also form a heterodimer complex, which may affect the expression of various endogenous target genes. Consequently, a reporter cell line additionally expressing the active GAL4DBD-pATF6(N) fragment may show different cellular response compared to a normal cell line, and in turn the results of the reporter cell line may be distorted by exogenous and active GAL4DBD-pATF6(N) fragment. However, our GV-ATF6αΔN(aa 333?670) may not show the binding ability or transcriptional activity, which affect the expression of endogenous serum- or ER stress-dependent genes. Thus, we believe that our RIP reporter system represents a specific and reliable experimental tool to monitor RIP of ATF6α.
Therefore, this reporter system can be used to screen for genes, small-molecules, and protein-based drugs that can activate or inhibit RIP of ATF6α. Moreover, for other known transmembrane bZIP transcription factors including Luman/CREB3, OASIS/CREB3L1, BBF2H7/CREB3L2, CREB-H/CREB3L3, CREB4/AIbZIP/CREB3L4, and CREBL1/ATF6β (Bailey and O’Hare, 2007), if the optimal DNA fragment for cleavage of GAL4DBD-VP16AD(GV)-bZIP transcription factor is determined as shown in the present study, the resulting plasmid can be used to develop a new reporter system for monitoring RIP of the transmembrane bZIP transcription factor in the luciferase reporter cell line which contains a stably integrated 5X GAL4 site-luciferase gene.
We thank Mi-Jeong Kim and Kyung-Ju Ahn at University of Ulsan for technical assistance with data preparation. This research was supported by a grant (2017R1D1A1B03035248 to J.Y.M.) of the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education. This research was also supported by the Priority Research Centers Program (2014R1A6A1030318 to S.H.B.) and the Bio & Medical Technology Development Program (2017M3A9G7072745 to S.H.B.) of the NRF funded by the Korean government. Portions of this work were supported by National Institutes of Health (NIH) grants (CA198103, DK113171 and AG062190 to R.J.K.).
Suji Kim, and Chang-Hoon Woo
Mol. Cells 2018; 41(11): 964-970 https://doi.org/10.14348/molcells.2018.0111Jong-Il Shin, Yong-Joon Jeon, Sol Lee, Yoon Gyeong Lee, Ji Beom Kim, and Kyungho Lee
Mol. Cells 2019; 42(3): 252-261 https://doi.org/10.14348/molcells.2019.2440Jae-Seon So
Mol. Cells 2018; 41(8): 705-716 https://doi.org/10.14348/molcells.2018.0241