Mol. Cells 2018; 41(4): 301-310
Published online April 30, 2018
https://doi.org/10.14348/molcells.2018.2190
© The Korean Society for Molecular and Cellular Biology
Correspondence to : *Correspondence: choish@snu.ac.kr (SHC); hanc210@snu.ac.kr (NCH)
LysR-type transcriptional regulators (LTTRs) contain an N-terminal DNA binding domain (DBD) and a C-terminal regulatory domain (RD). Typically, LTTRs function as homotetramers. VV2_1132 was identified in
Keywords LysR type transcriptional regulator,
LysR-type transcriptional regulators (LTTRs) comprise the largest family of transcriptional regulators in prokaryotes and play diverse biological roles in virulence, motility, quorum sensing, and scavenging of oxidative stressors (Maddocks and Oyston, 2008). For instance, OxyR induces the transcription of many proteins scavenging the oxidative stresses by sensing the low level of H2O2 (Jo et al., 2017; Maddocks and Oyston, 2008). LTTRs share a common structural architecture consisting of an N-terminal DNA binding domain (DBD) and a C-terminal regulatory domain (RD), which are connected by a long linker helix in the DBD (Maddocks and Oyston, 2008; Muraoka et al., 2003). Crystal structures of LTTRs have revealed that the RD adopts two Rossmann fold-like subdomains (RD-I and RD-II) to recognize cognate ligands or stimuli (Choi et al., 2001; Lochowska et al., 2001; Park et al., 2017a). The DBD forms a stable dimer that thus has a pair of winged helix-turn-helix (wHTH) motifs for palindromic DNA binding (Alanazi et al., 2013; Choi et al., 2001; Jo et al., 2015; Maddocks and Oyston, 2008). The DBD contains a long linker helix with a hinge region that connects to the RD and consists of a flexible stretch of amino acids, providing interdomain flexibility.
Most LTTRs adopt a homotetrameric assembly in an asymmetric two dimer arrangement, since each dimer is composed of two subunits in different conformations between the DBD and the RD (Muraoka et al., 2003). In the tetramer, both DBD dimers are located at the bottom of the main body, which consists of two RD dimers facing each other. This arrangement of DBD dimers in the tetramer appears suited for binding to a DNA sequence composed of two (pseudo)palindromic sequences (Jo et al., 2015). The distance between the two DBD dimers is affected by ligand binding to the RDs, which controls DNA binding (Jo et al., 2015; Maddocks and Oyston, 2008).
The DNA constructs, protein expression, and purification of VV2_1132 have been previously described (Jang et al., 2017). Briefly, the gene for VV2_1132 was cloned into the pProEx-HTa vector (Invitrogen, USA), resulting in pProEX-HTa-VV2_1132. The VV2_1132 protein was overexpressed in
For production of SeMet-labeled protein, B834 (DE3) cells were transformed with the recombinant pProEx-HTa VV2_1132 plasmid. Cells were cultured in M9 medium supplemented with an amino acid mixture containing L-(+)-selenomethionine, 100 μg/mL ampicillin, and other cofactors (Guerrero et al., 2001). Cells were harvested, disrupted, and purified by the same method as for the native VV2_1132. The protein was concentrated to 9 mg/mL; stored in a buffer containing 20 mM Tris (pH 8.0), 150 mM NaCl, and 2 mM β-mercaptoethanol; and frozen at −80°C until use.
SEC-MALS experiments were performed using a High-performance liquid chromatography pump (Agilent) connected to a Superdex-200 10/300 GL (GE Healthcare) gel filtration column and a Wyatt DAWN HELIOS MALS instrument. The gel filtration column was pre-equilibrated with 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 2 mM β-mercaptoethanol. Bovine serum albumin at 2 mg/mL was used as a protein standard. The VV2_1132 protein sample at 3 mg/mL was injected into the column and eluted at a flow rate of 0.2 ml/min. The data were evaluated using the debye model for static light scattering data fitting and represented using an EASI graph with a RI peak in the ASTRA V software (Wyatt).
Native VV2_1132 protein was crystallized in precipitation solution containing 0.1 M imidazole (pH 7.6), 0.9 M ammonium phosphate dibasic, 0.2 M NaBr, and 2 mM TCEP at 14°C, as reported previously (Jang et al., 2017). SeMet-labeled VV2_1132 protein was crystallized under a precipitation solution containing 0.1 M imidazole (pH 7.6), 0.9 M ammonium phosphate dibasic, 0.2 M NaCl, and 2 mM TCEP. To collect the X-ray diffraction dataset, native and SeMet-labeled crystals were transferred for 1 min to 2 μl of cryoprotection buffer containing the precipitation solution supplemented with 30% sorbitol, after which the crystals were flash-cooled in liquid nitrogen. The diffraction dataset was collected using an undulator X-ray beam (beamline 5C in the Pohang Accelerator Laboratory, Pohang, Republic of Korea) (Park et al., 2017b) at a wavelength of 0.9801 Å. The native crystal belonged to the space group of
The strains and plasmids used in this study are listed in Table 2. Unless otherwise noted,
The VV2_1132 gene was inactivated
Wild-type
Bacterial motility was tested as described previously (Lim and Choi, 2014). Wild-type
Full-length VV2_1132 protein was successfully produced in the
Each protomer of VV2_1132 is composed of a DBD (residue 1–100) and an RD (residue 101–304). The overall fold is similar to that of typical LTTRs. The DBD can be divided into three distinct parts: a DNA binding region (1–66), a linker helix (residues 67–90), and a hinge region (residues 91–100) (Fig. 2). The DNA binding region contains a wHTH motif (α2 and α3) that is reinforced by an additional helix (α1). The RD is further divided into two subdomains, RD-I (residues 101–155, 284–300) and RD-II (residues 156–283), both of which adopt a Rossmann-fold topology. The RD-I subdomain is composed of three α helices (α5, α6, and α12) and five β strands (β1, β2, β3, β4, and β9). The RD-II subdomain is composed of five α helices (α7, α8, α9, α10, and α11) and six β strands (β4, β5, β6, β7, β8, and β9) (Fig. 2A).
Typical tetrameric LTTRs such as ArgP, AphB, and OxyR consist of two compact (or closed) subunits and two extended (or open) subunits (Jo et al., 2015; Taylor et al., 2012; Zhou et al., 2010). In the compact subunits, the linker helix of the DBD is in close contact with the RD-I region of the RD, while the DBD is fully spread from the RD in the extended subunit. The VV2_1132 tetramer is composed of two conformationally distinct subunits that are distinguished from both the compact and extended conformations of other LTTRs. We designated the two subunits of VV2_1132 as the inner subunits and the outer subunits (Fig. 2A). The DNA binding motif of the DBD is 36 Å from the center of the RD in the inner subunits, while the DNA binding motif is more than 48 Å from the RD in the outer subunits (Fig. 2A).
We compared the inner and outer subunits of VV2_1132 to the extended and compact subunits of
Like in other LTTRs, the VV2_1132 tetramer can be divided into two RD dimers and two DBD dimers because the RDs and DBDs have homophilic interactions, thus forming dimeric units. The overall structures of the VV2_1132 RD dimer and the DBD dimer are similar to those of typical LTTRs. At the interface of the RD dimers, hydrogen bonds between the β2 backbone of RD-I and the β7 backbone of RD-II contribute primarily to the interaction (Fig. 3A). Weak hydrophobic interactions between α6 of RD–I and α9 of RD–II are also partly involved in the dimeric interface (Fig. 3A). In the VV2_1132 DBD dimers, the linker helices in the DBD dimer form the main dimeric interfaces via mostly hydrophobic interactions (Jo et al., 2015) (Fig. 3B).
The interdomain orientation of the RD dimer is affected by the activation state of the LTTR. To determine which state the RD dimer adopts, the VV2_1132 RD dimer was superimposed onto an
In a typical LTTR tetramer, the RD of a compact subunit and the RD of an extended subunit form an RD dimer, as represented by the
The most striking feature is that one of the DBD dimers in the tetramer units is very unlikely to make direct contact with DNA because its DNA binding motifs are hidden within the tetramer, whereas the other DBD dimer has surface-exposed DNA binding motifs. In contrast, both DBD dimers of all other LTTRs can participate in DNA binding. The two DBD dimers of
To analyze the VV2_1132 tetramer further, we first focused on the two dimers formed by the RD-RD interface, referred to as RD-type dimers. The two RD-type dimers are equivalent because both are comprised of inner and outer subunits (Fig. 4B). The two DBDs in the RD-type dimer are biased to the inner subunit side, and the DBD of the outer subunit is near the inner subunit RD. No direct contact is made between the outer subunit DBD and the inner subunit RD (Fig. 4B). Unlike RD-type dimers, the two DBD-type dimers (whose dimeric interface is in the DBD) are not equivalent. One of the DBD-type dimers is formed by two inner subunits, while the other DBD-type dimer is formed by two outer subunits. In the DBD-type dimer formed by two inner subunits, the DNA binding motifs are located between the two RDs; thus, the DNA binding motifs are buried in the tetramer (Fig. 4C). In the other DBD-type dimer, the DNA binding motifs are surface-exposed (Fig. 5A). In a DNA docking model based on the BenM DBD structures in complex with DNA (Alanazi et al., 2013), the DNA fragment fit nicely into the DNA binding motif of the DBD dimer consisting of the outer subunits (Fig. 5B).
Like most LTTRs, VV2_1132 has small cavities at the ligand binding sites. These cavities are located between the RD-I and RD-II subdomains of the RDs. Since the cavities have been characterized as ligand binding sites in many LTTRs, it is likely that the cavities of VV2_1132 also function as ligand binding sites.
Interestingly, the putative ligand binding sites in the outer subunits are screened mutually by the loops in the DBD of an inner subunit (Fig. 6). A loop connecting α3 and α4 in the DBD of an inner subunit, referred to as a wing in the wHTH domain, blocks entry to the ligand binding site of the RD from the outer subunit via hydrophobic interactions of the Tyr57, Pro58, and Ile59 residues in the DBD and the Pro160, Leu162, and Phe206 residues in the RD (Fig. 6A). Superposition of the inner subunit and the outer subunit of RDs revealed a large movement of the loop of the RD, which interact with the loop of the DBD (Fig. 6B).
We added bromine ions in the crystallization solution as well as the storage buffer. Several bromine ions were found in the putative active sites, indicating that the ligand binding sites have the chemical environment for the bromine ion (Fig. 6C). This observation presents a possibility that the VV2_1132 can bind negatively charged ions or compounds as ligands. However, the bromine ion is not likely to be specific to the putative active sites because not all the putative ligand binding sites bind the bromine ions.
To explore the function of VV2_1132, we constructed a VV2_1132-deleted
Since VV2_1132 is related to
Many LTTR structures have been determined. This study presented the crystal structure of VV2_1132 from
It is obvious that the crystal structure does not contain the native ligand and the tetramer of VV2_1132 can bind to a DNA sequence with the DBD dimer in the outer subunits. We observed occlusion of the putative ligand binding sites by the connecting loops in this configuration. This observation suggests that the ligand binding and the DNA binding are coupled. For instance, the ligand binding to the outer subunits may cause a large movement of the DBDs, affecting the transcriptional regulation of this protein.
We next raised the question of how the transcriptional activity of the VV2_1132 tetramer could be regulated by binding of the putative ligand. Since ligand binding would not disrupt the internal tetramer symmetry, the motion induced by ligand binding should be related to the molecular 2-fold rotational axis of the tetramer. Thus, two possible motions can be postulated: 1) spinning of the DBD dimers around the 2-fold axis; and 2) translation of the DBD dimer along the axis. Both of these motions could affect the DNA binding ability of the tetramer. However, ligand-bound structures are required to elucidate the mechanism of regulation. It is of interest to determine the function of the buried DNA binding motifs in the inner subunits in the ligand-bound structures. To connect this novel configuration to the function of the protein, it is necessary to determine the function of the gene, which might be related to the physiology of this highly pathogenic bacterium.
This study provided a complete structure of a new LTTR protein, which showed a novel configuration. This information enriches the structural diversity of the LTTR family. Further studies will focus on revealing the mechanism by which the protein acts as a molecular switch in response to the appropriate ligand.
X-ray diffraction and refinement statistics
SeMet VV2_1132 | Native VV2_1132 | |
---|---|---|
Beam line | PAL 5C | PAL 5C |
Wavelength (Å) | 0.98010 | 1.00820 |
Space group | ||
Cell dimensions | ||
| 57.5, 111.1, 219.30 | 57.8, 113.5, 220.7 |
| 90, 90, 90 | 90, 90, 90 |
Resolution (Å) | 50.0–3.00 (3.05–3.00) | 50.0–2.20 (2.24–2.20) |
Rmerge | 0.104 (0.346) | 0.061 (0.494) |
Rpim | 0.033 (0.133) | 0.019 (0.214) |
High resolution shell CC1/2 | 0.740 | 0.219 |
16.6 (3.4) | 56.4 (4.5) | |
Completeness (%) | 98.8 (98.0) | 93.7(83,8) |
Redundancy | 8.3 (5.8) | 8.3 (4.6) |
Resolution (Å) | 2.20 | |
No. of reflections | 65417 | |
Rwork/Rfree | 0.2017/0.2636 | |
No. of total atoms | 9223 | |
Wilson B-factor (Å) | 2471 | |
R.M.S. deviations | ||
Bond lengths (Å) | 0.008 | |
Bond angles (°) | 0.955 | |
Ramachandran plot | ||
Favored (%) | 95.39 | |
Allowed (%) | 4.43 | |
Outliers (%) | 0.18 | |
PDB ID | 5Y9S |
*Values in parentheses are for the highest resolution shell.
Plasmids and bacterial strains used in this study
Strain or plasmid | Relevant characteristicsa | Reference or source |
---|---|---|
| ||
CMCP6 | Clinical isolate; virulent | Laboratory collection |
GR1619 | CMCP6 with ΔVV2_1132 | This study |
| ||
S17-1λ | λ- | Simon |
BL21(DE3) | Laboratory collection | |
pProEx-HTa | His6-tag fusion protein expression vector; Apr | Invitrogen |
pDM4 | R6K γ | Milton |
pGR1618 | pDM4 with ΔVV2_1132 | This study |
aTpr, trimethoprim resistant; Smr, streptomycin resistant; Cmr, chloramphenicol resistant.
Oligonucleotides used in this study
Name | Oligonucleotide Sequence (5′ → 3′)a, b | Use |
---|---|---|
VV21132_F1_F | GTATTTCCTTGCTCTGCCCATCC | Deletion of VV2_1132 ORF |
VV21132_F1_R | ||
VV21132_F2_F | Deletion of VV2_1132 ORF | |
VV21132_F2_R | GGCCTTTTTTATTAAGTAGTTGGTCAGATC | |
VV21132_Ex_F | Overexpression of VV2_1132 | |
VV21132_Ex_R |
aOligonucleotides were designed using the
bRegions of oligonucleotides not complementary to the corresponding gene are underlined.
Mol. Cells 2018; 41(4): 301-310
Published online April 30, 2018 https://doi.org/10.14348/molcells.2018.2190
Copyright © The Korean Society for Molecular and Cellular Biology.
Yongdae Jang1, Garam Choi1,2, Seokho Hong1, Inseong Jo1, Jinsook Ahn1, Sang Ho Choi1,2,*, and Nam-Chul Ha1,*
1Research Institute for Agriculture and Life Sciences, Center for Food and Bioconvergence, Center for Food Safety and Toxicology, Seoul National University, Seoul 08826, Korea, 2National Research Laboratory of Molecular Microbiology and Toxicology, Seoul National University, Seoul 08826, Korea
Correspondence to:*Correspondence: choish@snu.ac.kr (SHC); hanc210@snu.ac.kr (NCH)
LysR-type transcriptional regulators (LTTRs) contain an N-terminal DNA binding domain (DBD) and a C-terminal regulatory domain (RD). Typically, LTTRs function as homotetramers. VV2_1132 was identified in
Keywords: LysR type transcriptional regulator,
LysR-type transcriptional regulators (LTTRs) comprise the largest family of transcriptional regulators in prokaryotes and play diverse biological roles in virulence, motility, quorum sensing, and scavenging of oxidative stressors (Maddocks and Oyston, 2008). For instance, OxyR induces the transcription of many proteins scavenging the oxidative stresses by sensing the low level of H2O2 (Jo et al., 2017; Maddocks and Oyston, 2008). LTTRs share a common structural architecture consisting of an N-terminal DNA binding domain (DBD) and a C-terminal regulatory domain (RD), which are connected by a long linker helix in the DBD (Maddocks and Oyston, 2008; Muraoka et al., 2003). Crystal structures of LTTRs have revealed that the RD adopts two Rossmann fold-like subdomains (RD-I and RD-II) to recognize cognate ligands or stimuli (Choi et al., 2001; Lochowska et al., 2001; Park et al., 2017a). The DBD forms a stable dimer that thus has a pair of winged helix-turn-helix (wHTH) motifs for palindromic DNA binding (Alanazi et al., 2013; Choi et al., 2001; Jo et al., 2015; Maddocks and Oyston, 2008). The DBD contains a long linker helix with a hinge region that connects to the RD and consists of a flexible stretch of amino acids, providing interdomain flexibility.
Most LTTRs adopt a homotetrameric assembly in an asymmetric two dimer arrangement, since each dimer is composed of two subunits in different conformations between the DBD and the RD (Muraoka et al., 2003). In the tetramer, both DBD dimers are located at the bottom of the main body, which consists of two RD dimers facing each other. This arrangement of DBD dimers in the tetramer appears suited for binding to a DNA sequence composed of two (pseudo)palindromic sequences (Jo et al., 2015). The distance between the two DBD dimers is affected by ligand binding to the RDs, which controls DNA binding (Jo et al., 2015; Maddocks and Oyston, 2008).
The DNA constructs, protein expression, and purification of VV2_1132 have been previously described (Jang et al., 2017). Briefly, the gene for VV2_1132 was cloned into the pProEx-HTa vector (Invitrogen, USA), resulting in pProEX-HTa-VV2_1132. The VV2_1132 protein was overexpressed in
For production of SeMet-labeled protein, B834 (DE3) cells were transformed with the recombinant pProEx-HTa VV2_1132 plasmid. Cells were cultured in M9 medium supplemented with an amino acid mixture containing L-(+)-selenomethionine, 100 μg/mL ampicillin, and other cofactors (Guerrero et al., 2001). Cells were harvested, disrupted, and purified by the same method as for the native VV2_1132. The protein was concentrated to 9 mg/mL; stored in a buffer containing 20 mM Tris (pH 8.0), 150 mM NaCl, and 2 mM β-mercaptoethanol; and frozen at −80°C until use.
SEC-MALS experiments were performed using a High-performance liquid chromatography pump (Agilent) connected to a Superdex-200 10/300 GL (GE Healthcare) gel filtration column and a Wyatt DAWN HELIOS MALS instrument. The gel filtration column was pre-equilibrated with 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 2 mM β-mercaptoethanol. Bovine serum albumin at 2 mg/mL was used as a protein standard. The VV2_1132 protein sample at 3 mg/mL was injected into the column and eluted at a flow rate of 0.2 ml/min. The data were evaluated using the debye model for static light scattering data fitting and represented using an EASI graph with a RI peak in the ASTRA V software (Wyatt).
Native VV2_1132 protein was crystallized in precipitation solution containing 0.1 M imidazole (pH 7.6), 0.9 M ammonium phosphate dibasic, 0.2 M NaBr, and 2 mM TCEP at 14°C, as reported previously (Jang et al., 2017). SeMet-labeled VV2_1132 protein was crystallized under a precipitation solution containing 0.1 M imidazole (pH 7.6), 0.9 M ammonium phosphate dibasic, 0.2 M NaCl, and 2 mM TCEP. To collect the X-ray diffraction dataset, native and SeMet-labeled crystals were transferred for 1 min to 2 μl of cryoprotection buffer containing the precipitation solution supplemented with 30% sorbitol, after which the crystals were flash-cooled in liquid nitrogen. The diffraction dataset was collected using an undulator X-ray beam (beamline 5C in the Pohang Accelerator Laboratory, Pohang, Republic of Korea) (Park et al., 2017b) at a wavelength of 0.9801 Å. The native crystal belonged to the space group of
The strains and plasmids used in this study are listed in Table 2. Unless otherwise noted,
The VV2_1132 gene was inactivated
Wild-type
Bacterial motility was tested as described previously (Lim and Choi, 2014). Wild-type
Full-length VV2_1132 protein was successfully produced in the
Each protomer of VV2_1132 is composed of a DBD (residue 1–100) and an RD (residue 101–304). The overall fold is similar to that of typical LTTRs. The DBD can be divided into three distinct parts: a DNA binding region (1–66), a linker helix (residues 67–90), and a hinge region (residues 91–100) (Fig. 2). The DNA binding region contains a wHTH motif (α2 and α3) that is reinforced by an additional helix (α1). The RD is further divided into two subdomains, RD-I (residues 101–155, 284–300) and RD-II (residues 156–283), both of which adopt a Rossmann-fold topology. The RD-I subdomain is composed of three α helices (α5, α6, and α12) and five β strands (β1, β2, β3, β4, and β9). The RD-II subdomain is composed of five α helices (α7, α8, α9, α10, and α11) and six β strands (β4, β5, β6, β7, β8, and β9) (Fig. 2A).
Typical tetrameric LTTRs such as ArgP, AphB, and OxyR consist of two compact (or closed) subunits and two extended (or open) subunits (Jo et al., 2015; Taylor et al., 2012; Zhou et al., 2010). In the compact subunits, the linker helix of the DBD is in close contact with the RD-I region of the RD, while the DBD is fully spread from the RD in the extended subunit. The VV2_1132 tetramer is composed of two conformationally distinct subunits that are distinguished from both the compact and extended conformations of other LTTRs. We designated the two subunits of VV2_1132 as the inner subunits and the outer subunits (Fig. 2A). The DNA binding motif of the DBD is 36 Å from the center of the RD in the inner subunits, while the DNA binding motif is more than 48 Å from the RD in the outer subunits (Fig. 2A).
We compared the inner and outer subunits of VV2_1132 to the extended and compact subunits of
Like in other LTTRs, the VV2_1132 tetramer can be divided into two RD dimers and two DBD dimers because the RDs and DBDs have homophilic interactions, thus forming dimeric units. The overall structures of the VV2_1132 RD dimer and the DBD dimer are similar to those of typical LTTRs. At the interface of the RD dimers, hydrogen bonds between the β2 backbone of RD-I and the β7 backbone of RD-II contribute primarily to the interaction (Fig. 3A). Weak hydrophobic interactions between α6 of RD–I and α9 of RD–II are also partly involved in the dimeric interface (Fig. 3A). In the VV2_1132 DBD dimers, the linker helices in the DBD dimer form the main dimeric interfaces via mostly hydrophobic interactions (Jo et al., 2015) (Fig. 3B).
The interdomain orientation of the RD dimer is affected by the activation state of the LTTR. To determine which state the RD dimer adopts, the VV2_1132 RD dimer was superimposed onto an
In a typical LTTR tetramer, the RD of a compact subunit and the RD of an extended subunit form an RD dimer, as represented by the
The most striking feature is that one of the DBD dimers in the tetramer units is very unlikely to make direct contact with DNA because its DNA binding motifs are hidden within the tetramer, whereas the other DBD dimer has surface-exposed DNA binding motifs. In contrast, both DBD dimers of all other LTTRs can participate in DNA binding. The two DBD dimers of
To analyze the VV2_1132 tetramer further, we first focused on the two dimers formed by the RD-RD interface, referred to as RD-type dimers. The two RD-type dimers are equivalent because both are comprised of inner and outer subunits (Fig. 4B). The two DBDs in the RD-type dimer are biased to the inner subunit side, and the DBD of the outer subunit is near the inner subunit RD. No direct contact is made between the outer subunit DBD and the inner subunit RD (Fig. 4B). Unlike RD-type dimers, the two DBD-type dimers (whose dimeric interface is in the DBD) are not equivalent. One of the DBD-type dimers is formed by two inner subunits, while the other DBD-type dimer is formed by two outer subunits. In the DBD-type dimer formed by two inner subunits, the DNA binding motifs are located between the two RDs; thus, the DNA binding motifs are buried in the tetramer (Fig. 4C). In the other DBD-type dimer, the DNA binding motifs are surface-exposed (Fig. 5A). In a DNA docking model based on the BenM DBD structures in complex with DNA (Alanazi et al., 2013), the DNA fragment fit nicely into the DNA binding motif of the DBD dimer consisting of the outer subunits (Fig. 5B).
Like most LTTRs, VV2_1132 has small cavities at the ligand binding sites. These cavities are located between the RD-I and RD-II subdomains of the RDs. Since the cavities have been characterized as ligand binding sites in many LTTRs, it is likely that the cavities of VV2_1132 also function as ligand binding sites.
Interestingly, the putative ligand binding sites in the outer subunits are screened mutually by the loops in the DBD of an inner subunit (Fig. 6). A loop connecting α3 and α4 in the DBD of an inner subunit, referred to as a wing in the wHTH domain, blocks entry to the ligand binding site of the RD from the outer subunit via hydrophobic interactions of the Tyr57, Pro58, and Ile59 residues in the DBD and the Pro160, Leu162, and Phe206 residues in the RD (Fig. 6A). Superposition of the inner subunit and the outer subunit of RDs revealed a large movement of the loop of the RD, which interact with the loop of the DBD (Fig. 6B).
We added bromine ions in the crystallization solution as well as the storage buffer. Several bromine ions were found in the putative active sites, indicating that the ligand binding sites have the chemical environment for the bromine ion (Fig. 6C). This observation presents a possibility that the VV2_1132 can bind negatively charged ions or compounds as ligands. However, the bromine ion is not likely to be specific to the putative active sites because not all the putative ligand binding sites bind the bromine ions.
To explore the function of VV2_1132, we constructed a VV2_1132-deleted
Since VV2_1132 is related to
Many LTTR structures have been determined. This study presented the crystal structure of VV2_1132 from
It is obvious that the crystal structure does not contain the native ligand and the tetramer of VV2_1132 can bind to a DNA sequence with the DBD dimer in the outer subunits. We observed occlusion of the putative ligand binding sites by the connecting loops in this configuration. This observation suggests that the ligand binding and the DNA binding are coupled. For instance, the ligand binding to the outer subunits may cause a large movement of the DBDs, affecting the transcriptional regulation of this protein.
We next raised the question of how the transcriptional activity of the VV2_1132 tetramer could be regulated by binding of the putative ligand. Since ligand binding would not disrupt the internal tetramer symmetry, the motion induced by ligand binding should be related to the molecular 2-fold rotational axis of the tetramer. Thus, two possible motions can be postulated: 1) spinning of the DBD dimers around the 2-fold axis; and 2) translation of the DBD dimer along the axis. Both of these motions could affect the DNA binding ability of the tetramer. However, ligand-bound structures are required to elucidate the mechanism of regulation. It is of interest to determine the function of the buried DNA binding motifs in the inner subunits in the ligand-bound structures. To connect this novel configuration to the function of the protein, it is necessary to determine the function of the gene, which might be related to the physiology of this highly pathogenic bacterium.
This study provided a complete structure of a new LTTR protein, which showed a novel configuration. This information enriches the structural diversity of the LTTR family. Further studies will focus on revealing the mechanism by which the protein acts as a molecular switch in response to the appropriate ligand.
. X-ray diffraction and refinement statistics.
SeMet VV2_1132 | Native VV2_1132 | |
---|---|---|
Beam line | PAL 5C | PAL 5C |
Wavelength (Å) | 0.98010 | 1.00820 |
Space group | ||
Cell dimensions | ||
| 57.5, 111.1, 219.30 | 57.8, 113.5, 220.7 |
| 90, 90, 90 | 90, 90, 90 |
Resolution (Å) | 50.0–3.00 (3.05–3.00) | 50.0–2.20 (2.24–2.20) |
Rmerge | 0.104 (0.346) | 0.061 (0.494) |
Rpim | 0.033 (0.133) | 0.019 (0.214) |
High resolution shell CC1/2 | 0.740 | 0.219 |
16.6 (3.4) | 56.4 (4.5) | |
Completeness (%) | 98.8 (98.0) | 93.7(83,8) |
Redundancy | 8.3 (5.8) | 8.3 (4.6) |
Resolution (Å) | 2.20 | |
No. of reflections | 65417 | |
Rwork/Rfree | 0.2017/0.2636 | |
No. of total atoms | 9223 | |
Wilson B-factor (Å) | 2471 | |
R.M.S. deviations | ||
Bond lengths (Å) | 0.008 | |
Bond angles (°) | 0.955 | |
Ramachandran plot | ||
Favored (%) | 95.39 | |
Allowed (%) | 4.43 | |
Outliers (%) | 0.18 | |
PDB ID | 5Y9S |
*Values in parentheses are for the highest resolution shell.
. Plasmids and bacterial strains used in this study.
Strain or plasmid | Relevant characteristicsa | Reference or source |
---|---|---|
| ||
CMCP6 | Clinical isolate; virulent | Laboratory collection |
GR1619 | CMCP6 with ΔVV2_1132 | This study |
| ||
S17-1λ | λ- | Simon |
BL21(DE3) | Laboratory collection | |
pProEx-HTa | His6-tag fusion protein expression vector; Apr | Invitrogen |
pDM4 | R6K γ | Milton |
pGR1618 | pDM4 with ΔVV2_1132 | This study |
aTpr, trimethoprim resistant; Smr, streptomycin resistant; Cmr, chloramphenicol resistant.
. Oligonucleotides used in this study.
Name | Oligonucleotide Sequence (5′ → 3′)a, b | Use |
---|---|---|
VV21132_F1_F | GTATTTCCTTGCTCTGCCCATCC | Deletion of VV2_1132 ORF |
VV21132_F1_R | ||
VV21132_F2_F | Deletion of VV2_1132 ORF | |
VV21132_F2_R | GGCCTTTTTTATTAAGTAGTTGGTCAGATC | |
VV21132_Ex_F | Overexpression of VV2_1132 | |
VV21132_Ex_R |
aOligonucleotides were designed using the
bRegions of oligonucleotides not complementary to the corresponding gene are underlined.
Subin Kim, Jungyoon Yeon, Jongmin Sung, and Mi Sun Jin*
Mol. Cells 2020; 43(9): 831-840 https://doi.org/10.14348/molcells.2020.0168Zhili Rao, So Young Kim, Xiaotong Li, Da Som Kim, Yong Ju Kim, and Jung Hee Park
Mol. Cells 2020; 43(9): 784-792 https://doi.org/10.14348/molcells.2020.0136Jimin Park, Mi-Sun Kim, Keehyung Joo, Gil-Ja Jhon, Edward A. Berry, Jooyoung Lee, and Dong Hae Shin
Mol. Cells 2016; 39(6): 495-500 https://doi.org/10.14348/molcells.2016.0055