Mol. Cells 2022; 45(7): 479-494
Published online March 21, 2022
https://doi.org/10.14348/molcells.2022.5015
© The Korean Society for Molecular and Cellular Biology
Correspondence to : iho@catholic.ac.kr (IHO); hysuh@ajou.ac.kr (HSK)
This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/3.0/.
Human mesenchymal stem cells (MSCs) are multipotent stem cells that have been intensively studied as therapeutic tools for a variety of disorders. To enhance the efficacy of MSCs, therapeutic genes are introduced using retroviral and lentiviral vectors. However, serious adverse events (SAEs) such as tumorigenesis can be induced by insertional mutagenesis. We generated lentiviral vectors encoding the wild-type herpes simplex virus thymidine kinase (HSV-TK) gene and a gene containing a point mutation that results in an alanine to histidine substitution at residue 168 (TK(A168H)) and transduced expression in MSCs (MSC-TK and MSC-TK(A168H)). Transduction of lentiviral vectors encoding the TK(A168H) mutant did not alter the proliferation capacity, mesodermal differentiation potential, or surface antigenicity of MSCs. The MSC-TK(A168H) cells were genetically stable, as shown by karyotyping. MSC-TK(A168H) responded to ganciclovir (GCV) with an half maximal inhibitory concentration (IC50) value 10-fold less than that of MSC-TK. Because MSC-TK(A168H) cells were found to be non-tumorigenic, a U87-TK(A168H) subcutaneous tumor was used as a SAE-like condition and we evaluated the effect of valganciclovir (vGCV), an oral prodrug for GCV. U87-TK(A168H) tumors were more efficiently ablated by 200 mg/kg vGCV than U87-TK tumors. These results indicate that MSC-TK(A168H) cells appear to be pre-clinically safe for therapeutic use. We propose that genetic modification with HSV-TK(A168H) makes allogeneic MSC-based ex vivo therapy safer by eliminating transplanted cells during SAEs such as uncontrolled cell proliferation.
Keywords herpes simplex virus-thymidine kinase, lentiviral vector, mesenchymal stem cells, safety switch, stemness
Mesenchymal stem cells (MSCs) are self-renewing multipotent stem cells capable of differentiating into mesodermal lineages, such as adipogenic, osteogenic, and chondrogenic cells (Pittenger et al., 1999). MSCs also have the potential to transdifferentiate into ectodermal lineages (neurons and keratinocytes) (Dos Santos et al., 2019; Poudineh et al., 2018) and endodermal lineages (hepatocytes and cardiomyocytes) (Aurich et al., 2009; Sgodda et al., 2007; Szaraz et al., 2017). In addition to their differentiation potential into multiple lineages, MSCs have been considered as a cell-based drug to treat various neurological disorders, such as amyotrophic lateral sclerosis (Mazzini et al., 2003; Suzuki et al., 2008), Parkinson’s disease (Kan et al., 2007; Wang et al., 2010), Alzheimer’s disease (Ma et al., 2013; Yang et al., 2013), stroke (Lee et al., 2015; Xin et al., 2013), and non-neurological diseases, such as graft versus host diseases (Le Blanc et al., 2004), myocardial infraction (Huang et al., 2019), type 1 diabetes (Unsal et al., 2015) and severe asthma (Shin et al., 2021). More than 1,300 clinical trials are ongoing or have been completed worldwide using MSCs (https://www.clinicaltrials.gov, with a query of “mesenchymal stem cells” 2021), indicating the broad application and usefulness of naive MSCs in cell-based drug development.
Several genetic modification approaches have been applied to MSCs to enhance their therapeutic efficacy. Currently, viral vectors using adenoviruses, retroviruses, and lentiviruses are commonly used to transfer functional genes into MSCs, whereas transfection of non-viral vectors is inefficient (Kim et al., 2003; Park et al., 2015). Adenovirus vectors require high multiplicity of infection (MOI) for efficient transduction, which affects the growth kinetics and adipogenic differentiation of MSCs (Marasini et al., 2017).
In early studies, first-generation retrovirus encoding γc cDNA led to acute lymphoblastic leukemia in patients with X-linked severe combined immunodeficiency (SCID-X1) following infusion of transduced CD34+ hematopoietic stem cells. Extensive studies have shown that insertion of the retroviral long-term repeat (LTR) sequence leads to aberrant expression of oncogenes such as
The chromosomal integration of retroviral and lentiviral vectors allows for sustained gene expression but can be a double-edged sword—it can also cause serious side effects, such as uncontrolled cell growth by activating nearby oncogenes. To mitigate such possible risks, suicide genes such as herpes simplex virus thymidine kinase I (HSV-TK) and inducible caspase-9 have been included in viral vectors (Greco et al., 2015; Ramos et al., 2010). HSV-TK phosphorylates anti-viral agents such as ganciclovir (GCV) or acyclovir (ACV), thereby inducing the incorporation of GCV- or ACV-derivatives into nascent DNA, leading to cell death by apoptosis (Beltinger et al., 1999; Field et al., 1983; Reardon, 1989; Zhang et al., 2008). Previously, we developed MSCs to carry the cytosine deaminase gene for the therapy of brain tumor. CD exerts converts 5-fluorocytosine (a prodrug) to 5-fluorouracil (an anti-cancer drug) and eliminates neighboring cancer cells (Chang et al., 2010). In contrast to CD gene, the cytotoxic effect of HSV-TK is minimal to neighboring cells unless the cells communicate via gap junctions because GCV- or ACV-derivatives are not membrane-permeable. Therefore, HSV-TK may provide a better tool as a safety gene to abolish unwanted serious adverse events (SAEs) by inducing apoptosis of transplanted cells. Several TK mutants have been tested to reduce the binding competition of thymidine to GCV. In particular, TK(A168H), which contains a mutation resulting in a substitution of alanine to histidine at residue 168, has 4-fold higher GCV kinase activity than wild-type (WT) TK (Balzarini et al., 2006), thereby lowering the burden of using high-dose GCV in the clinical field. Thus, we hypothesized that the TK(A168H) mutant might function better than TK as a safety switch.
In this study, we engineered bone marrow-derived MSCs to express TK(A168H) using lentiviral vectors. We tested the stem cell characteristics, genetic stability, and tumorigenic potential of transduced MSCs. To explore the safety switch functions of TK(A168H), we compared the cytotoxic effects of TK and TK(A168H) in response to GCV. Because MSCs expressing TK(A168H) were not tumorigenic, we utilized the glioma cell line U87 expressing TK(A168H) to establish
All experimental procedures using animals were approved by the Institutional Animal Care and Use Committee (IACUC) of Ajou University School of Medicine, South Korea (No. 2020-0009). Immune-compromised mice such as NSG mice (NOD.Cg-
Human MSCs were purified from bone marrow aspirated from the iliac crest of a 19-year-old healthy donor for allogeneic transplantation. The MSCs were isolated as described previously (Kim et al., 2005) with approval from the Institutional Review Board of Ajou University Medical Center (No. AJIRB-BMR-KSP-20-040) with the informed consent of the patient. Briefly, mononucleate cells were collected and maintained as adherent cultures in Dulbecco’s Modified Eagle’s Medium (DMEM, Cat. No. LM 001-05; Welgene, Korea) supplemented with 10% fetal bovine serum (FBS, Cat. No. 16000-044; Gibco, USA), 100 U/ml penicillin, 100 µg/ml streptomycin (Cat. No. 15140-122; Gibco) and 10 ng/ml basic fibroblast growth factor (Cat. No. 100-18B; PeproTech, USA).
WT TK cDNA was polymerase chain reaction (PCR) amplified from pAL119- TK (Cat. No. 21911; Addgene, USA) using a forward (5’-ACCGGTGCCACCATGGCTTCGTACCCCTGC-3’) and a reverse primer (5’-ACCGGTCTCAGTTAGCCTCCCCCATC-3’). The product was subcloned into the pGEM-T-easy vector. To generate the TK(A168H) mutant, site-directed mutagenesis was carried out using a mutant forward primer (5’-CGCCATCCCATCGCCCACCTCCTGTGCTAC-3’) and mutant reverse primer (5’-GTAGCACAGGAGGTGGGCGATGGGATGGCG-3’) paired with the primers that were used to obtain TK cDNA. The mutant PCR product was also subcloned into the pGEM-T-easy vector. The puromycin resistance gene that is situated between the SV40 promoter and Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE) in the pLenti-Bicistronic plasmid (Cat. No. LV037; Applied Biological Materials [ABM], Canada) was replaced by TK and TK(A168H) cDNAs through a serial process of enzyme digestion and ligation. CopGFP cDNA was inserted into multiple cloning sites in the pLenti-Bicistronic plasmid from pLenti-GIII-CMV-GFP-2A-Puro (Cat. No. LV180162; ABM) to obtain pLenti-TK and pLenti-TK(A168H). As a result, TK gene expression was driven by the SV40 promoter and CopGFP expression was driven by the PGK promoter in our lentiviral transfer plasmids. These transfer plasmids were packaged into lentiviral vectors, Lenti-TK and Lenti-TK(A168H), in the Lenti-XTM 293T(293T-X) cell line (Cat. No. 632180; TaKaRa, USA), following a previously described method (Lee et al., 2020).
U87 cells and MSCs were transduced with Lenti-TK and Lenti-TK(A168H) virus for 8 h in the presence of 4 µg/ml polybrene to obtain U87-TK, U87-TK(A168H), MSC-TK, and MSC-TK(A168H) cell lines. U87/GFP without the TK gene was generated by transducing U87 cells with a pLL3.7-drived lentiviral vector (Park et al., 2013). All U87 cell lines were selected for CopGFP expression by fluorescence-activated cell sorting (FACS) after transduction, as described previously (Chang et al., 2020).
Briefly, U87-TK, U87-TK(A168H), MSC-TK, and MSC-TK(A168H) cells were harvested using 0.25% trypsin-EDTA (Cat. No. 25200056; Thermo Fisher Scientific, USA). After washing with phosphate-buffered saline (PBS), the cells were resuspended in eBioscienceTM Flow Cytometry Staining Buffer (Cat. No. 00422226; Invitrogen, USA). GFP-positive cells were sorted using an Attune NxT Acoustic Focusing Cytometer (Invitrogen) with AttuneTM NxT software. The percentage of GFP-positive cells was determined by FACS analysis.
To measure the expression of surface antigens in MSC-TK(A168H) or MSCs, FACS analysis was performed as described previously (Park et al., 2013). Briefly, cells were stained for 15 min at 25℃ with fluorochrome-conjugated antibodies against CD29 (Cat. No. 303003; BioLegend, USA), CD90 (Cat. No. 559869; BD Biosciences, USA), CD105 (Cat. No. 323205; BioLegend), CD34 (Cat. No. 343505; BioLegend), CD45 (Cat. No. 304011; BioLegend), HLA-DR (Cat. No. 560896; BD PharmingenTM, USA), and isotype control. The cells were washed with PBS and suspended in flow cytometry staining buffer. Cells were analyzed using an Attune NxT Acoustic Focusing Cytometer (Thermo Fisher Scientific) with AttuneTM NxT software.
When the cells were grown to confluence in 100 mm dishes, they were lysed in RIPA lysis and extraction buffer (Cat. No. 89901; Thermo Fisher Scientific) containing a protease inhibitor cocktail (P2714; Sigma-Aldrich, USA). After centrifugation at 12,000 ×
Naïve MSC and MSC-TK(A168H) cells were plated at a density of 5 × 104 in a 24-well plate and allowed to grow to confluence. Adipogenic and osteogenic differentiations were carried out by replacing the media every 2-3 days in StemPro™ osteogenesis differentiation media (Cat. No. A1007201; Thermo Fisher Scientific) and StemPro™ adipogenesis differentiation media (Cat. No. A1007001; Thermo Fisher Scientific). After 14 days, the differentiated cells were washed with PBS and fixed with 10% neutral buffered formalin (Cat. No. 015MIRA01; BBC Biochemical, USA). For adipogenesis, oil-red O staining was carried out and the number of oil-red O positive adipocytes was counted from 64 images taken from four independent samples under 10× magnification using Image Express Micro4 (Molecular Devices, USA). For osteogenesis, alizarin red S staining was performed, and at least 10 random images were taken from four independent samples using an EVOS M5000 imaging system (Thermo Fisher Scientific), and the positive area was measured semi-manually by excluding negative areas with the help of color thresholding from ImageJ software (ver. 1.53e; NIH, USA). For chondrogenesis, 3 × 105 cells were washed with PBS and centrifuged at 500 ×
MSCs and MSC-TK(A168H) cells were maintained by subculturing every 6-8 days in the growth media as mentioned above for human MSC isolation and culture methods. To compare the growth kinetics of MSCs with MSC-TK(A168H) cells, cells were stained with trypan blue and live cells in 0.4 µl of Countess® Cell Counting Chamber Slides were counted in duplicates per chamber (Thermo Fisher Scientific) at confluency and plated at a density of 1,000 cells/cm2 for the next passage in culture. Cell counts in two chambers were used to extrapolate cumulative cell numbers. All cell culture media were replaced with fresh media every 2-3 days. Cell population doubling time was calculated as previously described (Rothenburger et al., 2021).
Total RNA was extracted from the cells at confluence, and PCR was performed as described previously (Lee et al., 2020). Forward and reverse primers were used to amplify TK, connexin 40 (Cx40), Cx43, and Cx45. Expression of Human GAPDH was used to normalize RNA expression. The primer sequences used for qRT-PCR are listed in Table 1.
Karyotyping analysis was carried out in MSCs and MSC-TK(A168H) on passage 7 (P7) and P10 as described previously (Park et al., 2013) using CytoVision (Applied Imaging International, USA) at the Clinical Cytogenetics Laboratory at Ajou University Hospital (http://www.ajoumc.or.kr).
MSC-TK and MSC-TK(A168H) cells were seeded at a density of 2 × 103 cells/well, while U87-TK and U87-TK(A168H) cells were seeded at 1 × 104 cells/well in 12-well plates. After 24 h of incubation, cells were treated with GCV (Cat. No. G2536; Sigma-Aldrich), at the indicated concentrations. In MSCs, the media was replaced every two days with fresh growth media containing the indicated concentrations of GCV. On 6th day, 3-[4,5-dimethyl-thiazol-2-yl]-2, 5-diphenyltetrazolium bromide (MTT) was added to a final concentration of 0.5 mg/ml (Cat. No. M2128; Sigma-Aldrich). U87-driven cells were cultured as described above, except that the medium was not changed for the 4 days until MTT was added to the culture. After 2 h incubation, the MTT-formazan product was extracted in 500 µl/well dimethyl sulfoxide (DMSO) and the absorbance at 540 nm was measured. The viability of the treated cells was expressed relative to that of the untreated control cells as the mean ± SEM of eight and five independent experiments for MSC and U87 driven cells respectively.
To carry out the
To mimic a SAE, 106 each of U87-TK and U87-TK(A168H) cells in 100 µL of PBS containing 20% Corning® Matrigel® Growth Factor Reduced (GFR) Basement Membrane Matrix, LDEV-free (Cat. No. 354230; Corning) were injected subcutaneously into 6-week-old NSG or nude mice. After the tumor size reached approximately 100-300 mm3, the animals orally received 50, 200, 400, or 800 mg/kg of valganciclovir (vGCV, Cat. No. V0158; Tokyo Chemical Industry, Japan) dissolved in normal saline once daily for 14 days. Tumor dimensions were measured every 2 days with a caliper, and the volumes were calculated using the following formula: Volume = π/6 × length × width × height (Tomayko and Reynolds, 1989). U87-GFP cells were used in a similar manner to serve as a negative control.
Statistical analyses were performed SigmaPlotTM v14 software (Systat Software, USA). Data were analyzed using the Student’s
Plasmids encoding TK and TK(A168H) were packaged into lentiviral vectors in 293T-X cells and transduced into MSCs to obtain MSC-TK and MSC-TK(A168H) cells (Fig. 1A). FACS analysis indicated that copGFP was detected in 58% of MSC-TK and 56% of MSC-TK(A168H) cells (Fig. 1B). RT-PCR and western blot analyses showed similar levels of HSV-TK expression in MSC-TK and MSC-TK(A168H) cells (Figs. 1C and 1E). To address the gap junction-mediated bystander effect in TK-expressing MSCs, expression of the major components of gap junctions, such as Cx43, Cx40, and Cx45, were confirmed in MSCs, MSC-TK, and MSC-TK(A168H) cells. These cell lines expressed high levels of Cx43 and Cx45, but minimally expressed Cx40 (Fig. 1D). Expression of Cx43 was significantly higher in MSC-TK and MSC-TK(A168H) compared to MSCs. Cx40 gene expression was increased in MSC-TK(A168H) whereas Cx45 expression was similar in all cell lines. To compare the viabilities of cells expressing TK and TK(A168H), an MTT assay was carried out using MSC-TK and MSC-TK (A168H) cells. GCV was dissolved in DMSO and added to the culture to a final concentration of 10 µM. GCV inhibited cell growth for 6 days and half maximal inhibitory concentration (IC50) values, the concentration required to kill 50% of cells, were 0.130 ± 0.045 µM and 0.013 ± 0.004 µM for MSC-TK and MSC-TK(A168H) cells, respectively (Figs. 1F and 1G). The MSC-TK(A168H) IC50 value was 10-fold lower than that of MSC-TK cells. We found that the TK(A168H) substitution did not alter transcription or translation of the TK gene (Figs. 1C and 1E). Higher concentrations of GCV interfered with cell growth regardless of the status of HSV-TK, likely because of the high concentration of DMSO (data not shown). The results show that the cell lines expressed TK and TK(A168H) to a similar level. Thus, the approximately 10-fold higher responsiveness and lower IC50 value of MSC-TK(A168H) should be a result of the altered enzyme activity of TK(A168H) compared to TK. We focused on TK(A168H) as a safety switch in subsequent studies.
We characterized the cells to determine whether lentiviral transduction altered the stem cell-like properties of MSCs. MSCs and MSC-TK(A168H) cells were plated at a density of 5 × 104 cells per 100 mm dish and subcultured at the same density until P15, when the cells stopped growing. MSCs and MSC-TK(A168H) cells exponentially expanded by approximately 9- to 14-fold per subculturing every 6 days until P12 (Fig. 2A), after which the doubling time was dramatically increased (Fig. 2B). FACS analysis indicated that surface antigens including CD29, CD90, CD105 (positive), CD34, CD45, and HLA-DR (negative) were similar in both cell lines (Figs. 2C and 2D). The indistinguishable growth rates and surface antigenicity between both cell lines indicate that lentiviral transduction does not alter the growth kinetics or surface antigenic properties.
Next, we tested the differentiation potential of MSCs and MSC-TK(A168H) cells into mesodermal lineage cells. Both MSCs and MSC-TK(A168H) cells formed chondrogenic pellets (Fig. 3A). Like MSCs, copGFP-positive MSC-TK(A168H) cells secreted an Alcian blue-positive extracellular matrix (white arrow in Fig. 3A). Likewise, copGFP-positive MSC-TK(A168H) cells underwent adipogenic differentiation, as shown by oil red-positive lipid droplets (white arrow in Fig. 3B), and osteogenic differentiation, as shown by alizarin red-positive calcium deposition (white arrow in Fig. 3C). Quantitative analysis showed that the chondrogenic pellet SA and Alcian blue-positive area, the number of oil red-positive adipocytes, and the percentage of alizarin positive areas were similar between MSC-TK and MSC-TK(A168H) cells (Figs. 3D-3G). These findings suggest that HSV-TK(A168H)-expressing MSCs preserve their multilineage differentiation potential.
Although lentiviral vectors are known to be safe, chromosomal integration may induce tumorigenesis. We assessed the genomic stability of MSC-TK(A168H) cells in long-term culture using karyotyping analysis. MSC-TK(A168H) showed normal 46XY, as did naïve MSCs, at P7 and P10 (Figs. 4A and 4B, Supplementary Fig. S1). To assess tumorigenesis, we injected 106 MSCs and MSC-TK(A168H) cells, as well as U87 cells as a positive control, subcutaneously into NSG mice and monitored tumor formation. In the U87 injected group, the tumor was palpable 21 days after cell injection and reached a size of 5435.9 ± 375.8 mm3 (Figs. 4E and 4F). In contrast, tumor-like structures were absent in the MSC and MSC-TK(A168H) groups up to 180 days, when the experiment was concluded (Figs. 4C and 4D). These findings clearly suggest that MSCs transduced with Lenti-TK(A168H) vectors are genetically safe.
Because MSC-TK(A168H) cells are not tumorigenic, it is impossible to assess the functions of HSV-TK/GCV as a safety switch in the context of SAEs such as uncontrolled growth
Finally, we tested the usefulness of TK(A168H) as a safety switch in an
To compare the direct effect of TK and TK(A168H) with GCV while eliminating potential contributions of the secondary effects of the host immune system, we performed similar experiments in NSG mice in which B-, T-, and natural killer (NK)-cell development were severely impaired. Administration of 50-200 mg/kg vGCV lowered the tumor volume more effectively in the U87-TK(A168H) group than in the U87-TK group. In the U87-TK(A168H) group, it took 10 and 8 days to clear 90% of the initial tumor volume with 50 and 200 mg/kg, respectively (Fig. 6E). With the same doses of vGCV, it took 35 and 15 days to clear the tumor volume by more than 90% in the U87-TK group. As in nude mice, vGCV itself did not cause any weight loss at these doses (Fig. 6F). One animal each in the U87-TK and U87-TK(A168H) groups at 50 mg/kg showed tumor recurrence 62 and 70 days, respectively, after the last GCV administration, indicating that 50 mg/kg was not sufficient to completely eradicate tumor cells. Importantly tumor recurrence was never observed at 200 mg/kg up to 120 days after the last day of administration. These findings indicate that 200 mg/kg vGCV is sufficient to completely clear tumors without any obvious side effects. Hence, using the TK(A168H) mutant as a safety gene provides a way to prevent and cure possible tumorigenesis from transplanted cells in the
MSCs have been studied as drugs for cell-based therapies in a variety of disorders, such as tissue damage and degenerative diseases, but their efficacy is controversial. Disease-specific therapeutic genes have been introduced into MSCs via retrovirus and lentivirus to enhance the therapeutic potency of MSCs. A positive aspect of these chromosomally inserting viral vectors is that they allow for sustained expression of therapeutic genes to obtain uniformly competent cells after large-scale production. However, chromosomal integration can alter stem cell characteristics and cause unexpected SAEs. This study demonstrates the potential use of the HSV-TK(A168H) gene as an efficient safety switch to manage the potential risk of SAEs in lentivirus-based
Undifferentiated MSCs express human leukocyte antigen (HLA) class I, but not class II, such as HLA-DR (Le Blanc et al., 2003). The hypoimmunogenic nature of MSCs makes allogeneic transplantation feasible and makes them attractive as off-the-shelf therapeutics. In this study, we show that lentiviral transduction by itself does not alter the hypoimmunogenic properties of MSCs, and the resulting
Transduction of viral vectors may alter stem cell properties of MSCs. As mentioned earlier, using adenovirus at high MOI affects the growth and adipogenic differentiation of MSCs (Marasini et al., 2017). In contrast, transduction of lentiviral vectors did not interfere with the proliferation of MSC-TK(A168H) cells, and their growth eventually stopped after long-term culture, indicating that lentiviral transduction did not cause any malignant transformation (Fig. 2A). Consistent with these results, karyotyping analysis did not reveal any chromosomal instability (Fig. 4). Moreover, MSCs and MSC-TK(A168H) cells did not form solid tumors in NSG mice for 180 days after subcutaneous injection (Fig. 4). Taken together, these results indicate that lentivirus-based MSCs are safe in preclinical conditions. Previously, although retroviral transduction by itself did not alter the stem cell properties of MSCs (Park et al., 2013), retrovirus-mediated overexpression of a neurogenic transcription factor, neurogenin 1 (Ngn1), converts MSC fate from mesodermal to neuronal lineage (Kim et al., 2008). Therefore, it is possible that the mesodermal properties of MSCs can be affected by therapeutic genes loaded into the lentiviral vector. For example, lentiviral vectors encoding TRAF4 (TNF receptor-associated factor 4), p130 (a member of the retinoblastoma gene product, pRb), E2F4 (a transcriptional repressor), and microRNA-410 alter the differentiation potential of MSCs (Cen et al., 2020; Zhang et al., 2017; 2018). In contrast with these findings, we found that TK(A168H) overexpression did not alter the adipogenic, osteogenic, and chondrogenic differentiation potential of MSCs. Hence, the TK(A168H) gene can be utilized together with other therapeutic genes while preserving the differentiation ability of MSCs.
Although MSCs are known to be clinically safe, MSC-based
Although vGCV ≥ 200 mg/kg can completely ablate tumors, it takes 6 and 20 days in nude and NSG mice, respectively (compare Figs. 6B and 6E). The delayed response in NSG mice could be attributed to the fact that B-, T-, and NK-cell development is impaired in NSG mice, whereas only T-cell development is impaired in nude mice (Belizário, 2009). The data also suggest that immune cell contribution may play a secondary role in suppressing tumor growth. Our finding is in line with a previous report that HSV-TK/GCV induces antitumor NK cell activity in an orthotopic mouse model of prostate cancer (Hall et al., 1998). Taken together, rapid tumor ablation in nude mice compared to NSG mice can be enhanced by a combination of activated NK cells and HSV-TK/GCV-mediated apoptosis. NSG mice, rather than nude mouse-based xenograft models, is the preferred model to find the primary antitumor effects of new therapeutic agents without the involvement of secondary effects by NK cells.
Transducing cultured cells results in MSC-TK or MSC-TK(A168H) cells representing 56%-58% of the total cells, and the remaining cells do not express TK. GCV added to the culture exerted cytotoxicity to both TK-expressing and non-TK-expressing cells in the MTT assay (Figs. 1F and 1G). Because phosphorylated GCV molecules are polar and cannot penetrate the cell membrane, they exert effects by entering cells through gap junctions (Mesnil and Yamasaki, 2000; van Dillen et al., 2002). Indeed, MSCs express major components of gap junctions, such as Cx43, Cx40, and Cx45, and communicate with neighboring cells through gap junctions (Dilger et al., 2020; Valiunas et al., 2004). In this study, MSCs, MSC-TK, and MSC-TK(A168H) cells expressed high levels of Cx43 and Cx45 but minimally expressed Cx40 (Fig. 1D), which causes untransduced, TK-negative, copGFP-negative cells to be affected by GCV.
In MSC-TK cells, GFP was used as a surrogate gene instead of therapeutic genes of interest. Although MSC-TK cells are not oncogenic in pre-clinical study, introducing other therapeutic genes in MSC-based
Similar mutant TK.007, a codon optimized TK(A168H) has been previously tested as a safety switch to abolish SAE in blood cell-based
In summary, MSCs are clinically safe and are used worldwide. Attempts have been made to enhance therapeutic efficacy by introducing functional genes into MSCs. Including TK(A168H) in the viral vectors along with functional genes to enhance the therapeutic potential in the early development of viral vectors may be a promising strategy while achieving the high clinical safety standard of MSC-based
This research was supported by grants from the Korea Health Technology R&D Project through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of Health & Welfare (HI20C0457 to H.S.K.), the Ministry of Food and Drug Safety in 2021 (18172MFDS182-5 to H.S.K.) and the Technology development Program (S3030270 to D.Y.C.) funded by the Ministry of SMEs and Startups (MSS, Korea).
N.B. and T.Y.L. wrote the manuscript. N.B., T.Y.L., D.Y.C., and J.H.J. performed experiments. N.B., T.Y.L., D.Y.C., J.H.J., M.G.K., R.A., and S.S.K. analyzed the data. I.H.O. and H.S.K. provided funding and supervised the research. All authors read and approved the manuscript.
T.Y.L., D.Y.C., and H.S.K. are employees of and stock and/or option holders in Cell&Brain Co., Ltd. The other authors have no potential conflicts of interest to disclose.
qRT-PCR primer list
Gene | Forward primer sequence 5’-3’ | Reverse primer sequence 5’-3’ |
---|---|---|
HSV-TK | GGAGGACAGACACATCGACC | TATTGGCAAGCAGCCCGTAA |
Cx40 | CCTCTTCATATTCCGTATGCT | GTGGAGACGAAGATGATCTG |
Cx43 | CACATCAGGTGGACTGTTTCCTCT | TTAACCCGATCCTTAACGCCCTTG |
Cx45 | GAGCTTCCTGACTCGCCTGCT | CCCGGCTGTTCTGTGTTGCAC |
GAPDH | GTCTCCTCTGACTTCAACAGC | ACCACCCTGTTGCTGTAGCCAA |
Mol. Cells 2022; 45(7): 479-494
Published online July 31, 2022 https://doi.org/10.14348/molcells.2022.5015
Copyright © The Korean Society for Molecular and Cellular Biology.
Narayan Bashyal1,2,5 , Tae-Young Lee3,5
, Da-Young Chang3
, Jin-Hwa Jung1
, Min Gyeong Kim1,2
, Rakshya Acharya1
, Sung-Soo Kim1,2
, Il-Hoan Oh4,*
, and Haeyoung Suh-Kim1,2,3,*
1Department of Anatomy, Ajou University School of Medicine, Suwon 16499, Korea, 2Department of Biomedical Sciences, Graduate School, Ajou University School of Medicine, Suwon 16499, Korea, 3Research Center, Cell&Brain Co., Ltd., Jeonju 54871, Korea, 4Department of Medical Lifescience, The Catholic University of Korea, College of Medicine, Seoul 06591, Korea, 5These authors contributed equally to this work
Correspondence to:iho@catholic.ac.kr (IHO); hysuh@ajou.ac.kr (HSK)
This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/3.0/.
Human mesenchymal stem cells (MSCs) are multipotent stem cells that have been intensively studied as therapeutic tools for a variety of disorders. To enhance the efficacy of MSCs, therapeutic genes are introduced using retroviral and lentiviral vectors. However, serious adverse events (SAEs) such as tumorigenesis can be induced by insertional mutagenesis. We generated lentiviral vectors encoding the wild-type herpes simplex virus thymidine kinase (HSV-TK) gene and a gene containing a point mutation that results in an alanine to histidine substitution at residue 168 (TK(A168H)) and transduced expression in MSCs (MSC-TK and MSC-TK(A168H)). Transduction of lentiviral vectors encoding the TK(A168H) mutant did not alter the proliferation capacity, mesodermal differentiation potential, or surface antigenicity of MSCs. The MSC-TK(A168H) cells were genetically stable, as shown by karyotyping. MSC-TK(A168H) responded to ganciclovir (GCV) with an half maximal inhibitory concentration (IC50) value 10-fold less than that of MSC-TK. Because MSC-TK(A168H) cells were found to be non-tumorigenic, a U87-TK(A168H) subcutaneous tumor was used as a SAE-like condition and we evaluated the effect of valganciclovir (vGCV), an oral prodrug for GCV. U87-TK(A168H) tumors were more efficiently ablated by 200 mg/kg vGCV than U87-TK tumors. These results indicate that MSC-TK(A168H) cells appear to be pre-clinically safe for therapeutic use. We propose that genetic modification with HSV-TK(A168H) makes allogeneic MSC-based ex vivo therapy safer by eliminating transplanted cells during SAEs such as uncontrolled cell proliferation.
Keywords: herpes simplex virus-thymidine kinase, lentiviral vector, mesenchymal stem cells, safety switch, stemness
Mesenchymal stem cells (MSCs) are self-renewing multipotent stem cells capable of differentiating into mesodermal lineages, such as adipogenic, osteogenic, and chondrogenic cells (Pittenger et al., 1999). MSCs also have the potential to transdifferentiate into ectodermal lineages (neurons and keratinocytes) (Dos Santos et al., 2019; Poudineh et al., 2018) and endodermal lineages (hepatocytes and cardiomyocytes) (Aurich et al., 2009; Sgodda et al., 2007; Szaraz et al., 2017). In addition to their differentiation potential into multiple lineages, MSCs have been considered as a cell-based drug to treat various neurological disorders, such as amyotrophic lateral sclerosis (Mazzini et al., 2003; Suzuki et al., 2008), Parkinson’s disease (Kan et al., 2007; Wang et al., 2010), Alzheimer’s disease (Ma et al., 2013; Yang et al., 2013), stroke (Lee et al., 2015; Xin et al., 2013), and non-neurological diseases, such as graft versus host diseases (Le Blanc et al., 2004), myocardial infraction (Huang et al., 2019), type 1 diabetes (Unsal et al., 2015) and severe asthma (Shin et al., 2021). More than 1,300 clinical trials are ongoing or have been completed worldwide using MSCs (https://www.clinicaltrials.gov, with a query of “mesenchymal stem cells” 2021), indicating the broad application and usefulness of naive MSCs in cell-based drug development.
Several genetic modification approaches have been applied to MSCs to enhance their therapeutic efficacy. Currently, viral vectors using adenoviruses, retroviruses, and lentiviruses are commonly used to transfer functional genes into MSCs, whereas transfection of non-viral vectors is inefficient (Kim et al., 2003; Park et al., 2015). Adenovirus vectors require high multiplicity of infection (MOI) for efficient transduction, which affects the growth kinetics and adipogenic differentiation of MSCs (Marasini et al., 2017).
In early studies, first-generation retrovirus encoding γc cDNA led to acute lymphoblastic leukemia in patients with X-linked severe combined immunodeficiency (SCID-X1) following infusion of transduced CD34+ hematopoietic stem cells. Extensive studies have shown that insertion of the retroviral long-term repeat (LTR) sequence leads to aberrant expression of oncogenes such as
The chromosomal integration of retroviral and lentiviral vectors allows for sustained gene expression but can be a double-edged sword—it can also cause serious side effects, such as uncontrolled cell growth by activating nearby oncogenes. To mitigate such possible risks, suicide genes such as herpes simplex virus thymidine kinase I (HSV-TK) and inducible caspase-9 have been included in viral vectors (Greco et al., 2015; Ramos et al., 2010). HSV-TK phosphorylates anti-viral agents such as ganciclovir (GCV) or acyclovir (ACV), thereby inducing the incorporation of GCV- or ACV-derivatives into nascent DNA, leading to cell death by apoptosis (Beltinger et al., 1999; Field et al., 1983; Reardon, 1989; Zhang et al., 2008). Previously, we developed MSCs to carry the cytosine deaminase gene for the therapy of brain tumor. CD exerts converts 5-fluorocytosine (a prodrug) to 5-fluorouracil (an anti-cancer drug) and eliminates neighboring cancer cells (Chang et al., 2010). In contrast to CD gene, the cytotoxic effect of HSV-TK is minimal to neighboring cells unless the cells communicate via gap junctions because GCV- or ACV-derivatives are not membrane-permeable. Therefore, HSV-TK may provide a better tool as a safety gene to abolish unwanted serious adverse events (SAEs) by inducing apoptosis of transplanted cells. Several TK mutants have been tested to reduce the binding competition of thymidine to GCV. In particular, TK(A168H), which contains a mutation resulting in a substitution of alanine to histidine at residue 168, has 4-fold higher GCV kinase activity than wild-type (WT) TK (Balzarini et al., 2006), thereby lowering the burden of using high-dose GCV in the clinical field. Thus, we hypothesized that the TK(A168H) mutant might function better than TK as a safety switch.
In this study, we engineered bone marrow-derived MSCs to express TK(A168H) using lentiviral vectors. We tested the stem cell characteristics, genetic stability, and tumorigenic potential of transduced MSCs. To explore the safety switch functions of TK(A168H), we compared the cytotoxic effects of TK and TK(A168H) in response to GCV. Because MSCs expressing TK(A168H) were not tumorigenic, we utilized the glioma cell line U87 expressing TK(A168H) to establish
All experimental procedures using animals were approved by the Institutional Animal Care and Use Committee (IACUC) of Ajou University School of Medicine, South Korea (No. 2020-0009). Immune-compromised mice such as NSG mice (NOD.Cg-
Human MSCs were purified from bone marrow aspirated from the iliac crest of a 19-year-old healthy donor for allogeneic transplantation. The MSCs were isolated as described previously (Kim et al., 2005) with approval from the Institutional Review Board of Ajou University Medical Center (No. AJIRB-BMR-KSP-20-040) with the informed consent of the patient. Briefly, mononucleate cells were collected and maintained as adherent cultures in Dulbecco’s Modified Eagle’s Medium (DMEM, Cat. No. LM 001-05; Welgene, Korea) supplemented with 10% fetal bovine serum (FBS, Cat. No. 16000-044; Gibco, USA), 100 U/ml penicillin, 100 µg/ml streptomycin (Cat. No. 15140-122; Gibco) and 10 ng/ml basic fibroblast growth factor (Cat. No. 100-18B; PeproTech, USA).
WT TK cDNA was polymerase chain reaction (PCR) amplified from pAL119- TK (Cat. No. 21911; Addgene, USA) using a forward (5’-ACCGGTGCCACCATGGCTTCGTACCCCTGC-3’) and a reverse primer (5’-ACCGGTCTCAGTTAGCCTCCCCCATC-3’). The product was subcloned into the pGEM-T-easy vector. To generate the TK(A168H) mutant, site-directed mutagenesis was carried out using a mutant forward primer (5’-CGCCATCCCATCGCCCACCTCCTGTGCTAC-3’) and mutant reverse primer (5’-GTAGCACAGGAGGTGGGCGATGGGATGGCG-3’) paired with the primers that were used to obtain TK cDNA. The mutant PCR product was also subcloned into the pGEM-T-easy vector. The puromycin resistance gene that is situated between the SV40 promoter and Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE) in the pLenti-Bicistronic plasmid (Cat. No. LV037; Applied Biological Materials [ABM], Canada) was replaced by TK and TK(A168H) cDNAs through a serial process of enzyme digestion and ligation. CopGFP cDNA was inserted into multiple cloning sites in the pLenti-Bicistronic plasmid from pLenti-GIII-CMV-GFP-2A-Puro (Cat. No. LV180162; ABM) to obtain pLenti-TK and pLenti-TK(A168H). As a result, TK gene expression was driven by the SV40 promoter and CopGFP expression was driven by the PGK promoter in our lentiviral transfer plasmids. These transfer plasmids were packaged into lentiviral vectors, Lenti-TK and Lenti-TK(A168H), in the Lenti-XTM 293T(293T-X) cell line (Cat. No. 632180; TaKaRa, USA), following a previously described method (Lee et al., 2020).
U87 cells and MSCs were transduced with Lenti-TK and Lenti-TK(A168H) virus for 8 h in the presence of 4 µg/ml polybrene to obtain U87-TK, U87-TK(A168H), MSC-TK, and MSC-TK(A168H) cell lines. U87/GFP without the TK gene was generated by transducing U87 cells with a pLL3.7-drived lentiviral vector (Park et al., 2013). All U87 cell lines were selected for CopGFP expression by fluorescence-activated cell sorting (FACS) after transduction, as described previously (Chang et al., 2020).
Briefly, U87-TK, U87-TK(A168H), MSC-TK, and MSC-TK(A168H) cells were harvested using 0.25% trypsin-EDTA (Cat. No. 25200056; Thermo Fisher Scientific, USA). After washing with phosphate-buffered saline (PBS), the cells were resuspended in eBioscienceTM Flow Cytometry Staining Buffer (Cat. No. 00422226; Invitrogen, USA). GFP-positive cells were sorted using an Attune NxT Acoustic Focusing Cytometer (Invitrogen) with AttuneTM NxT software. The percentage of GFP-positive cells was determined by FACS analysis.
To measure the expression of surface antigens in MSC-TK(A168H) or MSCs, FACS analysis was performed as described previously (Park et al., 2013). Briefly, cells were stained for 15 min at 25℃ with fluorochrome-conjugated antibodies against CD29 (Cat. No. 303003; BioLegend, USA), CD90 (Cat. No. 559869; BD Biosciences, USA), CD105 (Cat. No. 323205; BioLegend), CD34 (Cat. No. 343505; BioLegend), CD45 (Cat. No. 304011; BioLegend), HLA-DR (Cat. No. 560896; BD PharmingenTM, USA), and isotype control. The cells were washed with PBS and suspended in flow cytometry staining buffer. Cells were analyzed using an Attune NxT Acoustic Focusing Cytometer (Thermo Fisher Scientific) with AttuneTM NxT software.
When the cells were grown to confluence in 100 mm dishes, they were lysed in RIPA lysis and extraction buffer (Cat. No. 89901; Thermo Fisher Scientific) containing a protease inhibitor cocktail (P2714; Sigma-Aldrich, USA). After centrifugation at 12,000 ×
Naïve MSC and MSC-TK(A168H) cells were plated at a density of 5 × 104 in a 24-well plate and allowed to grow to confluence. Adipogenic and osteogenic differentiations were carried out by replacing the media every 2-3 days in StemPro™ osteogenesis differentiation media (Cat. No. A1007201; Thermo Fisher Scientific) and StemPro™ adipogenesis differentiation media (Cat. No. A1007001; Thermo Fisher Scientific). After 14 days, the differentiated cells were washed with PBS and fixed with 10% neutral buffered formalin (Cat. No. 015MIRA01; BBC Biochemical, USA). For adipogenesis, oil-red O staining was carried out and the number of oil-red O positive adipocytes was counted from 64 images taken from four independent samples under 10× magnification using Image Express Micro4 (Molecular Devices, USA). For osteogenesis, alizarin red S staining was performed, and at least 10 random images were taken from four independent samples using an EVOS M5000 imaging system (Thermo Fisher Scientific), and the positive area was measured semi-manually by excluding negative areas with the help of color thresholding from ImageJ software (ver. 1.53e; NIH, USA). For chondrogenesis, 3 × 105 cells were washed with PBS and centrifuged at 500 ×
MSCs and MSC-TK(A168H) cells were maintained by subculturing every 6-8 days in the growth media as mentioned above for human MSC isolation and culture methods. To compare the growth kinetics of MSCs with MSC-TK(A168H) cells, cells were stained with trypan blue and live cells in 0.4 µl of Countess® Cell Counting Chamber Slides were counted in duplicates per chamber (Thermo Fisher Scientific) at confluency and plated at a density of 1,000 cells/cm2 for the next passage in culture. Cell counts in two chambers were used to extrapolate cumulative cell numbers. All cell culture media were replaced with fresh media every 2-3 days. Cell population doubling time was calculated as previously described (Rothenburger et al., 2021).
Total RNA was extracted from the cells at confluence, and PCR was performed as described previously (Lee et al., 2020). Forward and reverse primers were used to amplify TK, connexin 40 (Cx40), Cx43, and Cx45. Expression of Human GAPDH was used to normalize RNA expression. The primer sequences used for qRT-PCR are listed in Table 1.
Karyotyping analysis was carried out in MSCs and MSC-TK(A168H) on passage 7 (P7) and P10 as described previously (Park et al., 2013) using CytoVision (Applied Imaging International, USA) at the Clinical Cytogenetics Laboratory at Ajou University Hospital (http://www.ajoumc.or.kr).
MSC-TK and MSC-TK(A168H) cells were seeded at a density of 2 × 103 cells/well, while U87-TK and U87-TK(A168H) cells were seeded at 1 × 104 cells/well in 12-well plates. After 24 h of incubation, cells were treated with GCV (Cat. No. G2536; Sigma-Aldrich), at the indicated concentrations. In MSCs, the media was replaced every two days with fresh growth media containing the indicated concentrations of GCV. On 6th day, 3-[4,5-dimethyl-thiazol-2-yl]-2, 5-diphenyltetrazolium bromide (MTT) was added to a final concentration of 0.5 mg/ml (Cat. No. M2128; Sigma-Aldrich). U87-driven cells were cultured as described above, except that the medium was not changed for the 4 days until MTT was added to the culture. After 2 h incubation, the MTT-formazan product was extracted in 500 µl/well dimethyl sulfoxide (DMSO) and the absorbance at 540 nm was measured. The viability of the treated cells was expressed relative to that of the untreated control cells as the mean ± SEM of eight and five independent experiments for MSC and U87 driven cells respectively.
To carry out the
To mimic a SAE, 106 each of U87-TK and U87-TK(A168H) cells in 100 µL of PBS containing 20% Corning® Matrigel® Growth Factor Reduced (GFR) Basement Membrane Matrix, LDEV-free (Cat. No. 354230; Corning) were injected subcutaneously into 6-week-old NSG or nude mice. After the tumor size reached approximately 100-300 mm3, the animals orally received 50, 200, 400, or 800 mg/kg of valganciclovir (vGCV, Cat. No. V0158; Tokyo Chemical Industry, Japan) dissolved in normal saline once daily for 14 days. Tumor dimensions were measured every 2 days with a caliper, and the volumes were calculated using the following formula: Volume = π/6 × length × width × height (Tomayko and Reynolds, 1989). U87-GFP cells were used in a similar manner to serve as a negative control.
Statistical analyses were performed SigmaPlotTM v14 software (Systat Software, USA). Data were analyzed using the Student’s
Plasmids encoding TK and TK(A168H) were packaged into lentiviral vectors in 293T-X cells and transduced into MSCs to obtain MSC-TK and MSC-TK(A168H) cells (Fig. 1A). FACS analysis indicated that copGFP was detected in 58% of MSC-TK and 56% of MSC-TK(A168H) cells (Fig. 1B). RT-PCR and western blot analyses showed similar levels of HSV-TK expression in MSC-TK and MSC-TK(A168H) cells (Figs. 1C and 1E). To address the gap junction-mediated bystander effect in TK-expressing MSCs, expression of the major components of gap junctions, such as Cx43, Cx40, and Cx45, were confirmed in MSCs, MSC-TK, and MSC-TK(A168H) cells. These cell lines expressed high levels of Cx43 and Cx45, but minimally expressed Cx40 (Fig. 1D). Expression of Cx43 was significantly higher in MSC-TK and MSC-TK(A168H) compared to MSCs. Cx40 gene expression was increased in MSC-TK(A168H) whereas Cx45 expression was similar in all cell lines. To compare the viabilities of cells expressing TK and TK(A168H), an MTT assay was carried out using MSC-TK and MSC-TK (A168H) cells. GCV was dissolved in DMSO and added to the culture to a final concentration of 10 µM. GCV inhibited cell growth for 6 days and half maximal inhibitory concentration (IC50) values, the concentration required to kill 50% of cells, were 0.130 ± 0.045 µM and 0.013 ± 0.004 µM for MSC-TK and MSC-TK(A168H) cells, respectively (Figs. 1F and 1G). The MSC-TK(A168H) IC50 value was 10-fold lower than that of MSC-TK cells. We found that the TK(A168H) substitution did not alter transcription or translation of the TK gene (Figs. 1C and 1E). Higher concentrations of GCV interfered with cell growth regardless of the status of HSV-TK, likely because of the high concentration of DMSO (data not shown). The results show that the cell lines expressed TK and TK(A168H) to a similar level. Thus, the approximately 10-fold higher responsiveness and lower IC50 value of MSC-TK(A168H) should be a result of the altered enzyme activity of TK(A168H) compared to TK. We focused on TK(A168H) as a safety switch in subsequent studies.
We characterized the cells to determine whether lentiviral transduction altered the stem cell-like properties of MSCs. MSCs and MSC-TK(A168H) cells were plated at a density of 5 × 104 cells per 100 mm dish and subcultured at the same density until P15, when the cells stopped growing. MSCs and MSC-TK(A168H) cells exponentially expanded by approximately 9- to 14-fold per subculturing every 6 days until P12 (Fig. 2A), after which the doubling time was dramatically increased (Fig. 2B). FACS analysis indicated that surface antigens including CD29, CD90, CD105 (positive), CD34, CD45, and HLA-DR (negative) were similar in both cell lines (Figs. 2C and 2D). The indistinguishable growth rates and surface antigenicity between both cell lines indicate that lentiviral transduction does not alter the growth kinetics or surface antigenic properties.
Next, we tested the differentiation potential of MSCs and MSC-TK(A168H) cells into mesodermal lineage cells. Both MSCs and MSC-TK(A168H) cells formed chondrogenic pellets (Fig. 3A). Like MSCs, copGFP-positive MSC-TK(A168H) cells secreted an Alcian blue-positive extracellular matrix (white arrow in Fig. 3A). Likewise, copGFP-positive MSC-TK(A168H) cells underwent adipogenic differentiation, as shown by oil red-positive lipid droplets (white arrow in Fig. 3B), and osteogenic differentiation, as shown by alizarin red-positive calcium deposition (white arrow in Fig. 3C). Quantitative analysis showed that the chondrogenic pellet SA and Alcian blue-positive area, the number of oil red-positive adipocytes, and the percentage of alizarin positive areas were similar between MSC-TK and MSC-TK(A168H) cells (Figs. 3D-3G). These findings suggest that HSV-TK(A168H)-expressing MSCs preserve their multilineage differentiation potential.
Although lentiviral vectors are known to be safe, chromosomal integration may induce tumorigenesis. We assessed the genomic stability of MSC-TK(A168H) cells in long-term culture using karyotyping analysis. MSC-TK(A168H) showed normal 46XY, as did naïve MSCs, at P7 and P10 (Figs. 4A and 4B, Supplementary Fig. S1). To assess tumorigenesis, we injected 106 MSCs and MSC-TK(A168H) cells, as well as U87 cells as a positive control, subcutaneously into NSG mice and monitored tumor formation. In the U87 injected group, the tumor was palpable 21 days after cell injection and reached a size of 5435.9 ± 375.8 mm3 (Figs. 4E and 4F). In contrast, tumor-like structures were absent in the MSC and MSC-TK(A168H) groups up to 180 days, when the experiment was concluded (Figs. 4C and 4D). These findings clearly suggest that MSCs transduced with Lenti-TK(A168H) vectors are genetically safe.
Because MSC-TK(A168H) cells are not tumorigenic, it is impossible to assess the functions of HSV-TK/GCV as a safety switch in the context of SAEs such as uncontrolled growth
Finally, we tested the usefulness of TK(A168H) as a safety switch in an
To compare the direct effect of TK and TK(A168H) with GCV while eliminating potential contributions of the secondary effects of the host immune system, we performed similar experiments in NSG mice in which B-, T-, and natural killer (NK)-cell development were severely impaired. Administration of 50-200 mg/kg vGCV lowered the tumor volume more effectively in the U87-TK(A168H) group than in the U87-TK group. In the U87-TK(A168H) group, it took 10 and 8 days to clear 90% of the initial tumor volume with 50 and 200 mg/kg, respectively (Fig. 6E). With the same doses of vGCV, it took 35 and 15 days to clear the tumor volume by more than 90% in the U87-TK group. As in nude mice, vGCV itself did not cause any weight loss at these doses (Fig. 6F). One animal each in the U87-TK and U87-TK(A168H) groups at 50 mg/kg showed tumor recurrence 62 and 70 days, respectively, after the last GCV administration, indicating that 50 mg/kg was not sufficient to completely eradicate tumor cells. Importantly tumor recurrence was never observed at 200 mg/kg up to 120 days after the last day of administration. These findings indicate that 200 mg/kg vGCV is sufficient to completely clear tumors without any obvious side effects. Hence, using the TK(A168H) mutant as a safety gene provides a way to prevent and cure possible tumorigenesis from transplanted cells in the
MSCs have been studied as drugs for cell-based therapies in a variety of disorders, such as tissue damage and degenerative diseases, but their efficacy is controversial. Disease-specific therapeutic genes have been introduced into MSCs via retrovirus and lentivirus to enhance the therapeutic potency of MSCs. A positive aspect of these chromosomally inserting viral vectors is that they allow for sustained expression of therapeutic genes to obtain uniformly competent cells after large-scale production. However, chromosomal integration can alter stem cell characteristics and cause unexpected SAEs. This study demonstrates the potential use of the HSV-TK(A168H) gene as an efficient safety switch to manage the potential risk of SAEs in lentivirus-based
Undifferentiated MSCs express human leukocyte antigen (HLA) class I, but not class II, such as HLA-DR (Le Blanc et al., 2003). The hypoimmunogenic nature of MSCs makes allogeneic transplantation feasible and makes them attractive as off-the-shelf therapeutics. In this study, we show that lentiviral transduction by itself does not alter the hypoimmunogenic properties of MSCs, and the resulting
Transduction of viral vectors may alter stem cell properties of MSCs. As mentioned earlier, using adenovirus at high MOI affects the growth and adipogenic differentiation of MSCs (Marasini et al., 2017). In contrast, transduction of lentiviral vectors did not interfere with the proliferation of MSC-TK(A168H) cells, and their growth eventually stopped after long-term culture, indicating that lentiviral transduction did not cause any malignant transformation (Fig. 2A). Consistent with these results, karyotyping analysis did not reveal any chromosomal instability (Fig. 4). Moreover, MSCs and MSC-TK(A168H) cells did not form solid tumors in NSG mice for 180 days after subcutaneous injection (Fig. 4). Taken together, these results indicate that lentivirus-based MSCs are safe in preclinical conditions. Previously, although retroviral transduction by itself did not alter the stem cell properties of MSCs (Park et al., 2013), retrovirus-mediated overexpression of a neurogenic transcription factor, neurogenin 1 (Ngn1), converts MSC fate from mesodermal to neuronal lineage (Kim et al., 2008). Therefore, it is possible that the mesodermal properties of MSCs can be affected by therapeutic genes loaded into the lentiviral vector. For example, lentiviral vectors encoding TRAF4 (TNF receptor-associated factor 4), p130 (a member of the retinoblastoma gene product, pRb), E2F4 (a transcriptional repressor), and microRNA-410 alter the differentiation potential of MSCs (Cen et al., 2020; Zhang et al., 2017; 2018). In contrast with these findings, we found that TK(A168H) overexpression did not alter the adipogenic, osteogenic, and chondrogenic differentiation potential of MSCs. Hence, the TK(A168H) gene can be utilized together with other therapeutic genes while preserving the differentiation ability of MSCs.
Although MSCs are known to be clinically safe, MSC-based
Although vGCV ≥ 200 mg/kg can completely ablate tumors, it takes 6 and 20 days in nude and NSG mice, respectively (compare Figs. 6B and 6E). The delayed response in NSG mice could be attributed to the fact that B-, T-, and NK-cell development is impaired in NSG mice, whereas only T-cell development is impaired in nude mice (Belizário, 2009). The data also suggest that immune cell contribution may play a secondary role in suppressing tumor growth. Our finding is in line with a previous report that HSV-TK/GCV induces antitumor NK cell activity in an orthotopic mouse model of prostate cancer (Hall et al., 1998). Taken together, rapid tumor ablation in nude mice compared to NSG mice can be enhanced by a combination of activated NK cells and HSV-TK/GCV-mediated apoptosis. NSG mice, rather than nude mouse-based xenograft models, is the preferred model to find the primary antitumor effects of new therapeutic agents without the involvement of secondary effects by NK cells.
Transducing cultured cells results in MSC-TK or MSC-TK(A168H) cells representing 56%-58% of the total cells, and the remaining cells do not express TK. GCV added to the culture exerted cytotoxicity to both TK-expressing and non-TK-expressing cells in the MTT assay (Figs. 1F and 1G). Because phosphorylated GCV molecules are polar and cannot penetrate the cell membrane, they exert effects by entering cells through gap junctions (Mesnil and Yamasaki, 2000; van Dillen et al., 2002). Indeed, MSCs express major components of gap junctions, such as Cx43, Cx40, and Cx45, and communicate with neighboring cells through gap junctions (Dilger et al., 2020; Valiunas et al., 2004). In this study, MSCs, MSC-TK, and MSC-TK(A168H) cells expressed high levels of Cx43 and Cx45 but minimally expressed Cx40 (Fig. 1D), which causes untransduced, TK-negative, copGFP-negative cells to be affected by GCV.
In MSC-TK cells, GFP was used as a surrogate gene instead of therapeutic genes of interest. Although MSC-TK cells are not oncogenic in pre-clinical study, introducing other therapeutic genes in MSC-based
Similar mutant TK.007, a codon optimized TK(A168H) has been previously tested as a safety switch to abolish SAE in blood cell-based
In summary, MSCs are clinically safe and are used worldwide. Attempts have been made to enhance therapeutic efficacy by introducing functional genes into MSCs. Including TK(A168H) in the viral vectors along with functional genes to enhance the therapeutic potential in the early development of viral vectors may be a promising strategy while achieving the high clinical safety standard of MSC-based
This research was supported by grants from the Korea Health Technology R&D Project through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of Health & Welfare (HI20C0457 to H.S.K.), the Ministry of Food and Drug Safety in 2021 (18172MFDS182-5 to H.S.K.) and the Technology development Program (S3030270 to D.Y.C.) funded by the Ministry of SMEs and Startups (MSS, Korea).
N.B. and T.Y.L. wrote the manuscript. N.B., T.Y.L., D.Y.C., and J.H.J. performed experiments. N.B., T.Y.L., D.Y.C., J.H.J., M.G.K., R.A., and S.S.K. analyzed the data. I.H.O. and H.S.K. provided funding and supervised the research. All authors read and approved the manuscript.
T.Y.L., D.Y.C., and H.S.K. are employees of and stock and/or option holders in Cell&Brain Co., Ltd. The other authors have no potential conflicts of interest to disclose.
. qRT-PCR primer list.
Gene | Forward primer sequence 5’-3’ | Reverse primer sequence 5’-3’ |
---|---|---|
HSV-TK | GGAGGACAGACACATCGACC | TATTGGCAAGCAGCCCGTAA |
Cx40 | CCTCTTCATATTCCGTATGCT | GTGGAGACGAAGATGATCTG |
Cx43 | CACATCAGGTGGACTGTTTCCTCT | TTAACCCGATCCTTAACGCCCTTG |
Cx45 | GAGCTTCCTGACTCGCCTGCT | CCCGGCTGTTCTGTGTTGCAC |
GAPDH | GTCTCCTCTGACTTCAACAGC | ACCACCCTGTTGCTGTAGCCAA |
Subash Marasini, Da-Young Chang, Jin-Hwa Jung, Su-Jung Lee, Hye Lim Cha, Haeyoung Suh-Kim, and Sung-Soo Kim
Mol. Cells 2017; 40(8): 598-605 https://doi.org/10.14348/molcells.2017.0095Yosep Mo, Sung-Yoon Kang, Ji-Young Bang, Yujin Kim, Jiung Jeong, Eui-Man Jeong, Hye Young Kim, Sang-Heon Cho, and Hye-Ryun Kang
Mol. Cells 2022; 45(11): 833-845 https://doi.org/10.14348/molcells.2022.0038Jae Woo Shin, Seungwon Ryu, Jongho Ham, Keehoon Jung, Sangho Lee, Doo Hyun Chung, Hye-Ryun Kang, and Hye Young Kim
Mol. Cells 2021; 44(8): 580-590 https://doi.org/10.14348/molcells.2021.0101