Mol. Cells 2015; 38(11): 991-997
Published online November 4, 2015
https://doi.org/10.14348/molcells.2015.0197
© The Korean Society for Molecular and Cellular Biology
Correspondence to : *Correspondence: kangss@gnu.ac.kr (SSK), jwpark@ulasan.ac.kr (JWP).
Tristetraprolin (TTP) is an AU-rich elements (AREs)-binding protein, which regulates the decay of AREs-containing mRNAs such as proto-oncogenes, anti-apoptotic genes and immune regulatory genes. Despite the low expression of TTP in various human cancers, the mechanism involving suppressed expression of TTP is not fully understood. Here, we demonstrate that Resveratrol (3,5,4′-trihydroxystilbene, Res), a naturally occurring compound, induces glioma cell apoptosis through activation of tristetraprolin (TTP). Res increased TTP expression in U87MG human glioma cells. Res-induced TTP destabilized the urokinase plasminogen activator and urokinase plasminogen activator receptor mRNAs by binding to the ARE regions containing the 3′ untranslated regions of their mRNAs. Furthermore, TTP induced by Res suppressed cell growth and induced apoptosis in the human glioma cells. Because of its regulation of TTP expression, these findings suggest that the bioactive dietary compound Res can be used as a novel anti-cancer agent for the treatment of human malignant gliomas.
Keywords apoptosis, glioma, resveratrol, TTP, uPA, uPAR
Malignant gliomas are the most common primary tumors arising within the brain (Nakada et al., 2007). Although surgery and subsequent chemotherapy are the usual treatments for gliomas, most malignant gliomas are strongly resistant to apoptosis induced by chemotherapeutic agents. Because several mechanisms, including the blood-brain barrier (BBB), restrict and control the sufficient delivery of chemotherapeutic agents, the prognosis of patients with malignant gliomas is very poor (Stupp et al., 2007; Villano et al., 2009). To treat malignant gliomas using chemotherapy, it is therefore necessary to use agents that readily pass through the BBB.
Resveratrol (3,5,4′-trihydroxystilbene, Res), a polyphenol compound found in diverse sources such as grape skin, red wine, various berries, peanuts, and other dietary products, is a potent anti-oxidant (Cucciolla et al., 2007; Dorai and Aggarwal, 2004; Fremont, 2000). Res has been reported to have anti-proliferative properties against several cancers such as breast, liver, pancreas, and colon cancers (Cucciolla et al., 2007). Res acts as a chemopreventive and anti-tumor agent,
Tristetraprolin (TTP) is an AU-rich elements (AREs)-binding protein that regulates the decay of ARE-containing mRNAs, such as proto-oncogenes, anti-apoptotic genes, and immune regulatory genes (Baou et al., 2009). TTP also regulates the decay of urokinase plasminogen activator (uPA) and urokinase plasminogen activator receptor (uPAR) transcripts (Ryu et al., 2015), suggesting a potential role for TTP in invasion and tumor growth. A previous study reported that TTP expression was suppressed in human cancers, such as lung, breast, and cervix, and that the decline of functional TTP mediated diverse tumorigenic phenotypes (Brennan et al., 2009). However, the mechanism of TTP deficiency in cancer is not fully understood, and the development of novel agents to increase endogenous TTP expression is currently a high priority.
Here, we demonstrate that Res induces glioma cell apoptosis through activation of TTP. The expression of Res-induced TTP destabilized uPA and uPAR mRNAs by binding to the ARE regions containing 3′ untranslated regions (3′ UTR) of their mRNAs. Furthermore, increased expression of TTP by Res suppressed cell growth and induced apoptosis in human glioma cells. Together, these results suggest that Res can be used as an anti-cancer agent to treat human malignant gliomas by the regulation of the endogenous expression of TTP.
U87MG human glioma cells and normal human fibroblast (NHFB) cells (ATCC, USA) were maintained in the high glucose Dulbecco’s minimal essential medium (DMEM; Gibco, USA) supplemented with 10% fetal bovine serum (FBS; Gibco), 100 U/ml penicillin, and 100 μg/ml streptomycin (P/S; Gibco) in 5% CO2 at 37°C. For some studies, U87MG and NHFB cells were cultured in DMEM without FBS in the presence of designated concentrations of Res (5?200 μM) (Tocris, USA).
Total RNA was extracted using TRIzol reagent (Invitrogen, USA) following the manufacturer’s instructions. Total RNA (1 μg) was used for cDNA synthesis using an iCycler thermocycler (Bio-Rad Laboratories, USA). RT-PCR was performed using rTaq polymerase (Elpis Biotech, Korea). Primers were synthesized based on the reported human cDNA sequences for uPA, uPAR, and hGAPDH in the NCBI data bank. Sequences of the primers used for PCR were as follows; TTP: AGGCCAATCGCCACCCCAAA, GTGCCAGGGGCAGCAGA GAA; uPA: ACTTCTCCAACATTCACTGG, ATTCTTCTGG AGGAGAGGAG; uPAR: TGCCCGGGCTCCAATGGTTT, ATT CTTCTGGAGGAGAGGAG; hGAPDH:AGCTGAACGGGAAG CTCACT, TGCTGTAGCCAAATTCGTTG (Bioneer Corporation, Korea).
For RNA kinetic analysis, uPA and uPAR mRNAs were assessed in the presence of actinomycin D (Sigma-Aldrich, USA) by quantitative real-time PCR (Q-PCR). Q-PCR was performed using EvaGreen qPCR Mastermix (Applied Biological Materials Inc., Canada) in a Light Cycler 480 II (Roche Applied Science, USA). The results were analyzed by the melting curve analysis and agarose gel electrophoresis. PCR primer pairs were as follows: quPA: CCCTGCCTGCCCTGGAACTC, AGCGGCTT TAGGCCCACCTG; quPAR: CATTGACTGCCGAGGCCCCA, TGCTGAAGGCGTCACCCAGG; qhGAPDH: GCACCCCTG GCCAAGGTCAT, ACGCCACAGTTTCCCGGAGG (Bioneer Corporation).
Equivalent amounts of total protein (20?30 μg) were separated by SDS-PAGE on 8?12% polyacrylamide gels and then transferred to nitrocellulose membranes (Whatman GmbH, Germany) using a semi-dry transfer apparatus (Bio-Rad Laboratories) submerged in transfer buffer (25 mM Tris, 192 mM glycine, 20% methanol, pH 8.3). The membrane was blocked with 5% skim milk in 0.1% Tween-20/Tris-buffered saline (TTBS), and then incubated with the appropriate dilutions of primary and secondary antibodies. Antibodies to the following proteins were used: TTP, α-tubulin, and β-actin (Sigma-Aldrich), and uPA and uPAR (Epitomics, USA). Immunoreactivity was detected by chemiluminescence (ECL; Advansta, USA) using LAS 4000 (Fujifilm, Japan).
U87MG cells were transfected with the TTP-expressing pcDNA6/V5-HisA vector (pcDNA6/V5-TTP) (Invitrogen) (Lee et al., 2010) using the TurboFect™
For luciferase assays, U87MG cells were co-transfected with the designated construct, such as psiCHECK-Frag-uPA or uPAR 3′ UTR, and pcDNA6/V5-TTP
The biotinylated RNA probes for the wild-type uPA-ARE-WT, ACUCCUGUACACUGAAUAGCAUAUUUCACUAUUUUUAU UUAUAUUUUUGUAAUUUUAAA; and uPAR-ARE-WT, GUUG UUGUUAUUAAUUAAUAUUCAU-AUUAUUUAUUUUAUACU CAUAAAGAUUUUGUACC were synthesized by Samchully Pharm. Co. Ltd. (Korea). The mutant (MuT) RNA probes as negative controls were substituted into AGCA from AUUUA sequences of uPA and uPAR ARE-WT. Cytoplasmic extracts were prepared from Res treated U87MG cells using the NE-PER Nuclear and Cytoplasmic Extraction Reagent (Thermo Pierce Biotechnology Scientific, USA). RNA EMSA was performed using the LightShiftTM Chemiluminescent EMSA Kit.
U87MG cells were seeded in 96-well plates at a density of 3 × 103 cells/well. After the designated treatments, 100 μl of MTT solution (2 mg/ml) were added to each well, and the cells were incubated at 37°C for an additional 2 h. Dimethyl sulfoxide (DMSO) was added and mixed thoroughly, and the absorbance was measured at 570 nm using an Infinite M200 Pro (Tecan).
Cells were seeded on pre-coated coverslips (Nalge Nunc International, USA). Following treatment, the cells were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 10 min followed by permeabilization with 0.1% Triton X-100 in PBS for 5 min. After three washes with PBS, the specimens were labeled using an
The siRNAs against human TTP (sc-36761) and control siRNA (scrambled siRNA [scRNA], (sc-37007) were purchased from Santa Cruz Biotechnology (USA). U87MG cells were transfected with TTP-siRNA using Lipofectamine™ RNAiMAX (Invitrogen). At 24 h after transfection, U87MG cells were treated with Res.
Data are expressed as the mean ± SEM. Statistical significance was determined using Student′s
To investigate the effects of Res on the endogenous expression of TTP in U87MG human glioma cells, TTP mRNA and protein expression were measured by RT-PCR and Western blotting, respectively. Cells were treated with dose- and time-dependent Res treatments. Both TTP mRNA and protein expression were significantly increased by the treatment with 100 μM of Res (Fig. 1A). Furthermore, Res treatment (100 μM) maximally increased the expression of TTP mRNA and protein at 12 h and 24 h, respectively (Fig. 1B). These results show that Res increased the expression of endogenous TTP in U87MG cells.
A previous study reported that TTP mediated the stability of uPA and uPAR transcripts associated with the invasion and tumor growth in human breast cancer cells (Al-Souhibani et al., 2010). To test the effects of Res-induced TTP on uPA and uPAR expression, the expression of uPA and uPAR mRNAs and protein were determined by RT-PCR and Western blotting, respectively. Res treatment increased the expression of TTP, and both uPA and uPAR expression were inversely diminished by Res treatment (Fig. 2A). These results show that increased expression of TTP by Res inhibited uPA and uPAR expression in U87MG cells.
To determine whether down-regulation of uPA and uPAR expression by Res-induced TTP was regulated through the decay of their mRNAs, the half-life of these mRNAs was assessed by Q-PCR in U87MG cells. In U87MG cells treated with DMSO (U87MG/CTL), both uPA and uPAR mRNAs were stable for 2 h and 3 h after actinomycin D treatment, respectively. In contrast, in U87MG cells treated with Res (U87MG/Res), the half-life of these mRNAs decreased to less than 2 h and 3 h, respectively (Fig. 2B). These results indicate that Res-induced TTP led to the decay of uPA and uPAR mRNAs.
To determine whether Res-induced TTP mediated destabilization of uPA and uPAR mRNAs in association with 3′ UTR of their mRNAs, U87MG cells were co-transfected with the psiCHECK2 luciferase expression vector containing uPA or uPAR 3′ UTR fragments. After being transfected with pcDNA6/V5-TTP, U87MG cells treated with Res significantly inhibited the luciferase activity of uPA and uPAR (Figs. 3B and 3C). These results suggest that the 3′ UTR of uPA and uPAR mRNAs might be essential for destabilization of their mRNAs through the inhibitory activity of Res-induced TTP.
To investigate whether Res-induced TTP directly binds to the ARE regions containing the 3′ UTR of uPA and uPAR mRNAs, RNA EMSA was conducted using biotinylated RNA probes containing the WT or MuT AREs of uPA and uPAR. The RNA probes used in RNA EMSA were the same as those used in the luciferase assay. The MuT RNA probes serving as negative controls were substituted into AGCA from AUUUA sequences of uPA and uPAR ARE-WT. Cytoplasmic extracts were prepared from U87MG cells treated with Res and incubated with biotinylated RNA probes containing the WT or MuT AREs of uPA and uPAR 3′ UTR. When RNA EMSA was performed using the uPA-ARE-WT and uPAR-ARE-WT probes, a dominant RNA-protein complex was observed. However, both uPA-ARE-MuT and uPAR-ARE-MuT prevented the formation of this complex. Complex formation was decreased with an anti-TTP antibody (Ab) (Fig. 4). Together, these results indicate that Res-induced TTP controlled the expression of uPA and uPAR mRNAs in an AREs-dependent manner.
To determine whether the expression of Res-induced TTP affected human glioma cell growth, glioma cell growth was measured for 72 h using the MTT assay. Res treatment (5?200 μM) was used to treat U87MG cells, and showed growth inhibition using a concentration of 100 μM at 24 h. At 72 h after Res treatment, Res suppressed cell growth at 20?200 μM in a dose-dependent manner (Fig. 5A). Res treatment of NHFB cells obtained the same results at 72 h. However, Res treatment of NHFB cells for 24 h and 48 h inhibited cell growth at a concentration of 200 μM (Supplementary Fig. S1). Taken together, these results suggest that increased expression of TTP by Res inhibited U87MG cell growth.
Previous studies reported that down-regulation of uPA and uPAR activated caspase-mediated apoptosis and inhibited the PI3K/AKT pathway in human glioma cells (Gondi et al., 2007). Figure 2A shows that the increased expression of TTP by Res inhibited uPA and uPAR expression in U87MG cells. TUNEL assay was used to identify whether the expression of Res-induced TTP affected glioma cell apoptosis in the U87MG/Res or U87MG/CTL cells. In U87MG/Res cells, TUNEL-positive cells increased approximately 50% compared with the U87MG/CTL cells (Figs. 5B and 5C). In addition, the Res treatment raised cleaved caspase-3 expression through up-regulation of TTP expression in U87MG cells (Fig. 5D). These results show that the expression of Res potentiated apoptosis in the human glioma cells.
To determine whether Res could mediate the apoptotic effects of TTP in glioma cells, we investigated the effects of TTP knock down on Res-induced glioma cell apoptosis. After Res treatment, treatment with siRNA against TTP (TTP-siRNA) significantly inhibited the expression of TTP in U87MG cells (Fig. 6A). Importantly, TTP-siRNA but not scRNA decreased the inhibitory effect of Res on the growth of U87MG cells (Fig. 6B). We also found that TTP-siRNA did not affect Res-induced apoptosis in U87MG cells. Using TTP-siRNA, Res-induced TUNEL-positive cells decreased by approximately 60% compared with scRNA (Figs. 6C and 6D). These results suggest that TTP is required for Res-induced apoptosis of U87MG cells.
Despite low expression of TTP in various human cancers (Brennan et al., 2009), the mechanism responsible for this decreased TTP expression is not fully understood. In the present study, we showed that Res, a naturally occurring compound, inhibited cell growth and activated apoptosis through the up-regulation of endogenous TTP expression in the human glioma cells.
Previous studies have reported that Res suppressed the invasion, angiogenesis and tumor growth of gliomas (Jiang et al., 2005; Ryu et al., 2011; Tseng et al., 2004). Most importantly, Res was quickly converted into hydrophilic conjugates, that promoted entry into the bloodstream and allowed passage through the blood-brain barrier and subsequent absorption into the brain tissue (Wang et al., 2002). These results suggested that Res might be potentially valuable in the treatment of brain tumors (Castino et al., 2011).
The present study shows that Res treatment increased the expression of endogenous TTP in the U87MG human glioma cells (Figs. 1A and 1B). Currently, one mechanism, which explains the lack of TTP in cancers, has been transcriptional silencing as a result of the hypermethylation of CpG islands extant in the TTP promoter (Young et al., 2009). In many disease processes such as cancer, gene promoter CpG islands are abnormally hypermethylated as a result of a modification of the DNA methyltransferase (DNMT) expression and activity, which results in transcriptional gene silencing (Meeran et al., 2010). Several bioactive dietary components have great potential in altering DNA methylation by altering DNMT levels during cancer prevention and therapy (Li and Tollefsbol, 2010). In previous studies, Res has been shown to have DNMT inhibitory activity. Res interrupted epigenetic silencing of breast cancer-1 (BRCA-1) induced by the aromatic hydrocarbon receptor (AHR) in the MCF-7 human breast cancer cells (Papoutsis et al., 2010; Stefanska et al., 2010). These results suggested that Res treatment increased the expression of endogenous TTP by blocking the epigenetic silencing of TTP by DNMT inhibitory activity. TTP regulated the decay of uPA and uPAR transcripts associated with the invasion and tumor growth in human breast cancer cells (Al-Souhibani et al., 2010). The present study shows that the increased expression of TTP by Res inhibited the expression of uPA and uPAR mRNAs and proteins (Fig. 2A). Furthermore, the expression of Res-induced TTP promoted the decay of uPA and uPAR mRNAs (Fig. 2B). Posttranscriptional regulation of uPA and uPAR mRNA expression was facilitated by the existence of AREs in the 3′UTR of these mRNAs (Nanbu et al., 1994; Roldan et al., 1990). Specifically, Res-induced TTP directly bound to the ARE regions containing the 3′ UTR of uPA and uPAR mRNAs (Figs. 4A and 4B). Overall, the results of the present study show that TTP is a regulator of uPA and uPAR mRNA turnover.
The down-regulation of uPA and uPAR using the antisense adenovirus-mediated constructs in SNB19 glioma cells resulted in decreased migration and invasion, and retarded intracranial tumor growth in nude mice (Gondi et al., 2003). The expression of Res-induced TTP in U87MG cells (Fig. 5A) inhibited cell growth compared with the NHFB cells (Supplementary Fig. S1). The down-regulation of uPA and uPAR expression lead to the dephosphorylation of p-Akt, the activation of caspase-8, and a collapse in the mitochondrial membrane potential as revealed by the release of cytochrome c into the enclosing cytoplasm (Gondi et al., 2007). Together, the results showed that the increased expression of TTP by Res inhibited cell growth through the down-regulation of uPA and uPAR expression in the U87MG cells.
The present study also demonstrated that the expression of Res-potentiated TTP induced apoptosis in the human glioma cells (Figs. 5B?5D). Importantly, the inhibition of TTP by siRNA attenuated the effects of Res on both cell growth (Fig. 6B) and apoptosis (Figs. 6C and 6D). These results indicate that TTP mediated the apoptotic effect of Res on human glioma cells. In many previous studies, TTP has multiple cellular functions, including roles in cell survival, proliferation, differentiation, apoptosis and tumorigenesis. TTP mediated cell-cycle arrest and cell death through regulation of p21/CIP1/WAF-1 (Al-Haj et al., 2012). TTP overexpression also enhances the decay of Pim-1 mRNA by binding to the AU-rich element in its 3′-UTR (Kim et al., 2012). Therefore, TTP directly regulated cell death through decay of p21 mRNA. Furthermore, TTP indirectly regulated cell death through decay of pim1 mRNA. In particular, TTP induced an apoptotic program of cell death in human glioma cells (Suswam et al., 2008). In addition to Res, the other agents such as doxycycline (DOX) also induced the expression of TTP in human cancer cells (Lee et al., 2013). However, it is not known whether TTP induction by other agents involved the same mechanisms therefore further studies are needed to characterize the mechanism mediating TTP expression by diverse agents, including Res.
In summary, the present study demonstrated that Res increased TTP expression in the human glioma cells. The expression of Res-induced TTP were determined to destabilized uPA and uPAR mRNAs by the direct binding to the ARE regions containing the 3′ UTR regions of their mRNAs. Furthermore, the increased expression of TTP by Res suppressed cell growth and induced apoptosis in the human glioma cells. These findings suggest that by regulating TTP expression, several bioactive dietary compounds such as Res can be used as novel anti-cancer agents for the treatment of malignant gliomas.
Mol. Cells 2015; 38(11): 991-997
Published online November 30, 2015 https://doi.org/10.14348/molcells.2015.0197
Copyright © The Korean Society for Molecular and Cellular Biology.
Jinhyun Ryu1, Nal Ae Yoon1, Hyemin Seong1, Joo Yeon Jeong1, Seokmin Kang1, Nammi Park2, Jungil Choi3, Dong Hoon Lee1, Gu Seob Roh1, Hyun Joon Kim1, Gyeong Jae Cho1, Wan Sung Choi1, Jae-Yong Park4, Jeong Woo Park5,*, and Sang Soo Kang1,*
1Department of Anatomy and Convergence Medical Science, Institute of Health Science, School of Medicine, Gyeongsang National University, Jinju 52727, Korea, 2Department of Physiology, Institute of Health Sciences, School of Medicine, Gyeongsang National University, Jinju 52727, Korea, 3Gyeongnam Department of Environmental Toxicology and Chemistry, Korea Institute of Toxicology (KIT), Jinju 660-844, Korea, 4School of Biosystem and Biomedical Science, College of Health Science, Korea University, Seoul 02841, Korea, 5Department of Biological Sciences, University of Ulsan, Ulsan 680-749, Korea
Correspondence to:*Correspondence: kangss@gnu.ac.kr (SSK), jwpark@ulasan.ac.kr (JWP).
Tristetraprolin (TTP) is an AU-rich elements (AREs)-binding protein, which regulates the decay of AREs-containing mRNAs such as proto-oncogenes, anti-apoptotic genes and immune regulatory genes. Despite the low expression of TTP in various human cancers, the mechanism involving suppressed expression of TTP is not fully understood. Here, we demonstrate that Resveratrol (3,5,4′-trihydroxystilbene, Res), a naturally occurring compound, induces glioma cell apoptosis through activation of tristetraprolin (TTP). Res increased TTP expression in U87MG human glioma cells. Res-induced TTP destabilized the urokinase plasminogen activator and urokinase plasminogen activator receptor mRNAs by binding to the ARE regions containing the 3′ untranslated regions of their mRNAs. Furthermore, TTP induced by Res suppressed cell growth and induced apoptosis in the human glioma cells. Because of its regulation of TTP expression, these findings suggest that the bioactive dietary compound Res can be used as a novel anti-cancer agent for the treatment of human malignant gliomas.
Keywords: apoptosis, glioma, resveratrol, TTP, uPA, uPAR
Malignant gliomas are the most common primary tumors arising within the brain (Nakada et al., 2007). Although surgery and subsequent chemotherapy are the usual treatments for gliomas, most malignant gliomas are strongly resistant to apoptosis induced by chemotherapeutic agents. Because several mechanisms, including the blood-brain barrier (BBB), restrict and control the sufficient delivery of chemotherapeutic agents, the prognosis of patients with malignant gliomas is very poor (Stupp et al., 2007; Villano et al., 2009). To treat malignant gliomas using chemotherapy, it is therefore necessary to use agents that readily pass through the BBB.
Resveratrol (3,5,4′-trihydroxystilbene, Res), a polyphenol compound found in diverse sources such as grape skin, red wine, various berries, peanuts, and other dietary products, is a potent anti-oxidant (Cucciolla et al., 2007; Dorai and Aggarwal, 2004; Fremont, 2000). Res has been reported to have anti-proliferative properties against several cancers such as breast, liver, pancreas, and colon cancers (Cucciolla et al., 2007). Res acts as a chemopreventive and anti-tumor agent,
Tristetraprolin (TTP) is an AU-rich elements (AREs)-binding protein that regulates the decay of ARE-containing mRNAs, such as proto-oncogenes, anti-apoptotic genes, and immune regulatory genes (Baou et al., 2009). TTP also regulates the decay of urokinase plasminogen activator (uPA) and urokinase plasminogen activator receptor (uPAR) transcripts (Ryu et al., 2015), suggesting a potential role for TTP in invasion and tumor growth. A previous study reported that TTP expression was suppressed in human cancers, such as lung, breast, and cervix, and that the decline of functional TTP mediated diverse tumorigenic phenotypes (Brennan et al., 2009). However, the mechanism of TTP deficiency in cancer is not fully understood, and the development of novel agents to increase endogenous TTP expression is currently a high priority.
Here, we demonstrate that Res induces glioma cell apoptosis through activation of TTP. The expression of Res-induced TTP destabilized uPA and uPAR mRNAs by binding to the ARE regions containing 3′ untranslated regions (3′ UTR) of their mRNAs. Furthermore, increased expression of TTP by Res suppressed cell growth and induced apoptosis in human glioma cells. Together, these results suggest that Res can be used as an anti-cancer agent to treat human malignant gliomas by the regulation of the endogenous expression of TTP.
U87MG human glioma cells and normal human fibroblast (NHFB) cells (ATCC, USA) were maintained in the high glucose Dulbecco’s minimal essential medium (DMEM; Gibco, USA) supplemented with 10% fetal bovine serum (FBS; Gibco), 100 U/ml penicillin, and 100 μg/ml streptomycin (P/S; Gibco) in 5% CO2 at 37°C. For some studies, U87MG and NHFB cells were cultured in DMEM without FBS in the presence of designated concentrations of Res (5?200 μM) (Tocris, USA).
Total RNA was extracted using TRIzol reagent (Invitrogen, USA) following the manufacturer’s instructions. Total RNA (1 μg) was used for cDNA synthesis using an iCycler thermocycler (Bio-Rad Laboratories, USA). RT-PCR was performed using rTaq polymerase (Elpis Biotech, Korea). Primers were synthesized based on the reported human cDNA sequences for uPA, uPAR, and hGAPDH in the NCBI data bank. Sequences of the primers used for PCR were as follows; TTP: AGGCCAATCGCCACCCCAAA, GTGCCAGGGGCAGCAGA GAA; uPA: ACTTCTCCAACATTCACTGG, ATTCTTCTGG AGGAGAGGAG; uPAR: TGCCCGGGCTCCAATGGTTT, ATT CTTCTGGAGGAGAGGAG; hGAPDH:AGCTGAACGGGAAG CTCACT, TGCTGTAGCCAAATTCGTTG (Bioneer Corporation, Korea).
For RNA kinetic analysis, uPA and uPAR mRNAs were assessed in the presence of actinomycin D (Sigma-Aldrich, USA) by quantitative real-time PCR (Q-PCR). Q-PCR was performed using EvaGreen qPCR Mastermix (Applied Biological Materials Inc., Canada) in a Light Cycler 480 II (Roche Applied Science, USA). The results were analyzed by the melting curve analysis and agarose gel electrophoresis. PCR primer pairs were as follows: quPA: CCCTGCCTGCCCTGGAACTC, AGCGGCTT TAGGCCCACCTG; quPAR: CATTGACTGCCGAGGCCCCA, TGCTGAAGGCGTCACCCAGG; qhGAPDH: GCACCCCTG GCCAAGGTCAT, ACGCCACAGTTTCCCGGAGG (Bioneer Corporation).
Equivalent amounts of total protein (20?30 μg) were separated by SDS-PAGE on 8?12% polyacrylamide gels and then transferred to nitrocellulose membranes (Whatman GmbH, Germany) using a semi-dry transfer apparatus (Bio-Rad Laboratories) submerged in transfer buffer (25 mM Tris, 192 mM glycine, 20% methanol, pH 8.3). The membrane was blocked with 5% skim milk in 0.1% Tween-20/Tris-buffered saline (TTBS), and then incubated with the appropriate dilutions of primary and secondary antibodies. Antibodies to the following proteins were used: TTP, α-tubulin, and β-actin (Sigma-Aldrich), and uPA and uPAR (Epitomics, USA). Immunoreactivity was detected by chemiluminescence (ECL; Advansta, USA) using LAS 4000 (Fujifilm, Japan).
U87MG cells were transfected with the TTP-expressing pcDNA6/V5-HisA vector (pcDNA6/V5-TTP) (Invitrogen) (Lee et al., 2010) using the TurboFect™
For luciferase assays, U87MG cells were co-transfected with the designated construct, such as psiCHECK-Frag-uPA or uPAR 3′ UTR, and pcDNA6/V5-TTP
The biotinylated RNA probes for the wild-type uPA-ARE-WT, ACUCCUGUACACUGAAUAGCAUAUUUCACUAUUUUUAU UUAUAUUUUUGUAAUUUUAAA; and uPAR-ARE-WT, GUUG UUGUUAUUAAUUAAUAUUCAU-AUUAUUUAUUUUAUACU CAUAAAGAUUUUGUACC were synthesized by Samchully Pharm. Co. Ltd. (Korea). The mutant (MuT) RNA probes as negative controls were substituted into AGCA from AUUUA sequences of uPA and uPAR ARE-WT. Cytoplasmic extracts were prepared from Res treated U87MG cells using the NE-PER Nuclear and Cytoplasmic Extraction Reagent (Thermo Pierce Biotechnology Scientific, USA). RNA EMSA was performed using the LightShiftTM Chemiluminescent EMSA Kit.
U87MG cells were seeded in 96-well plates at a density of 3 × 103 cells/well. After the designated treatments, 100 μl of MTT solution (2 mg/ml) were added to each well, and the cells were incubated at 37°C for an additional 2 h. Dimethyl sulfoxide (DMSO) was added and mixed thoroughly, and the absorbance was measured at 570 nm using an Infinite M200 Pro (Tecan).
Cells were seeded on pre-coated coverslips (Nalge Nunc International, USA). Following treatment, the cells were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 10 min followed by permeabilization with 0.1% Triton X-100 in PBS for 5 min. After three washes with PBS, the specimens were labeled using an
The siRNAs against human TTP (sc-36761) and control siRNA (scrambled siRNA [scRNA], (sc-37007) were purchased from Santa Cruz Biotechnology (USA). U87MG cells were transfected with TTP-siRNA using Lipofectamine™ RNAiMAX (Invitrogen). At 24 h after transfection, U87MG cells were treated with Res.
Data are expressed as the mean ± SEM. Statistical significance was determined using Student′s
To investigate the effects of Res on the endogenous expression of TTP in U87MG human glioma cells, TTP mRNA and protein expression were measured by RT-PCR and Western blotting, respectively. Cells were treated with dose- and time-dependent Res treatments. Both TTP mRNA and protein expression were significantly increased by the treatment with 100 μM of Res (Fig. 1A). Furthermore, Res treatment (100 μM) maximally increased the expression of TTP mRNA and protein at 12 h and 24 h, respectively (Fig. 1B). These results show that Res increased the expression of endogenous TTP in U87MG cells.
A previous study reported that TTP mediated the stability of uPA and uPAR transcripts associated with the invasion and tumor growth in human breast cancer cells (Al-Souhibani et al., 2010). To test the effects of Res-induced TTP on uPA and uPAR expression, the expression of uPA and uPAR mRNAs and protein were determined by RT-PCR and Western blotting, respectively. Res treatment increased the expression of TTP, and both uPA and uPAR expression were inversely diminished by Res treatment (Fig. 2A). These results show that increased expression of TTP by Res inhibited uPA and uPAR expression in U87MG cells.
To determine whether down-regulation of uPA and uPAR expression by Res-induced TTP was regulated through the decay of their mRNAs, the half-life of these mRNAs was assessed by Q-PCR in U87MG cells. In U87MG cells treated with DMSO (U87MG/CTL), both uPA and uPAR mRNAs were stable for 2 h and 3 h after actinomycin D treatment, respectively. In contrast, in U87MG cells treated with Res (U87MG/Res), the half-life of these mRNAs decreased to less than 2 h and 3 h, respectively (Fig. 2B). These results indicate that Res-induced TTP led to the decay of uPA and uPAR mRNAs.
To determine whether Res-induced TTP mediated destabilization of uPA and uPAR mRNAs in association with 3′ UTR of their mRNAs, U87MG cells were co-transfected with the psiCHECK2 luciferase expression vector containing uPA or uPAR 3′ UTR fragments. After being transfected with pcDNA6/V5-TTP, U87MG cells treated with Res significantly inhibited the luciferase activity of uPA and uPAR (Figs. 3B and 3C). These results suggest that the 3′ UTR of uPA and uPAR mRNAs might be essential for destabilization of their mRNAs through the inhibitory activity of Res-induced TTP.
To investigate whether Res-induced TTP directly binds to the ARE regions containing the 3′ UTR of uPA and uPAR mRNAs, RNA EMSA was conducted using biotinylated RNA probes containing the WT or MuT AREs of uPA and uPAR. The RNA probes used in RNA EMSA were the same as those used in the luciferase assay. The MuT RNA probes serving as negative controls were substituted into AGCA from AUUUA sequences of uPA and uPAR ARE-WT. Cytoplasmic extracts were prepared from U87MG cells treated with Res and incubated with biotinylated RNA probes containing the WT or MuT AREs of uPA and uPAR 3′ UTR. When RNA EMSA was performed using the uPA-ARE-WT and uPAR-ARE-WT probes, a dominant RNA-protein complex was observed. However, both uPA-ARE-MuT and uPAR-ARE-MuT prevented the formation of this complex. Complex formation was decreased with an anti-TTP antibody (Ab) (Fig. 4). Together, these results indicate that Res-induced TTP controlled the expression of uPA and uPAR mRNAs in an AREs-dependent manner.
To determine whether the expression of Res-induced TTP affected human glioma cell growth, glioma cell growth was measured for 72 h using the MTT assay. Res treatment (5?200 μM) was used to treat U87MG cells, and showed growth inhibition using a concentration of 100 μM at 24 h. At 72 h after Res treatment, Res suppressed cell growth at 20?200 μM in a dose-dependent manner (Fig. 5A). Res treatment of NHFB cells obtained the same results at 72 h. However, Res treatment of NHFB cells for 24 h and 48 h inhibited cell growth at a concentration of 200 μM (Supplementary Fig. S1). Taken together, these results suggest that increased expression of TTP by Res inhibited U87MG cell growth.
Previous studies reported that down-regulation of uPA and uPAR activated caspase-mediated apoptosis and inhibited the PI3K/AKT pathway in human glioma cells (Gondi et al., 2007). Figure 2A shows that the increased expression of TTP by Res inhibited uPA and uPAR expression in U87MG cells. TUNEL assay was used to identify whether the expression of Res-induced TTP affected glioma cell apoptosis in the U87MG/Res or U87MG/CTL cells. In U87MG/Res cells, TUNEL-positive cells increased approximately 50% compared with the U87MG/CTL cells (Figs. 5B and 5C). In addition, the Res treatment raised cleaved caspase-3 expression through up-regulation of TTP expression in U87MG cells (Fig. 5D). These results show that the expression of Res potentiated apoptosis in the human glioma cells.
To determine whether Res could mediate the apoptotic effects of TTP in glioma cells, we investigated the effects of TTP knock down on Res-induced glioma cell apoptosis. After Res treatment, treatment with siRNA against TTP (TTP-siRNA) significantly inhibited the expression of TTP in U87MG cells (Fig. 6A). Importantly, TTP-siRNA but not scRNA decreased the inhibitory effect of Res on the growth of U87MG cells (Fig. 6B). We also found that TTP-siRNA did not affect Res-induced apoptosis in U87MG cells. Using TTP-siRNA, Res-induced TUNEL-positive cells decreased by approximately 60% compared with scRNA (Figs. 6C and 6D). These results suggest that TTP is required for Res-induced apoptosis of U87MG cells.
Despite low expression of TTP in various human cancers (Brennan et al., 2009), the mechanism responsible for this decreased TTP expression is not fully understood. In the present study, we showed that Res, a naturally occurring compound, inhibited cell growth and activated apoptosis through the up-regulation of endogenous TTP expression in the human glioma cells.
Previous studies have reported that Res suppressed the invasion, angiogenesis and tumor growth of gliomas (Jiang et al., 2005; Ryu et al., 2011; Tseng et al., 2004). Most importantly, Res was quickly converted into hydrophilic conjugates, that promoted entry into the bloodstream and allowed passage through the blood-brain barrier and subsequent absorption into the brain tissue (Wang et al., 2002). These results suggested that Res might be potentially valuable in the treatment of brain tumors (Castino et al., 2011).
The present study shows that Res treatment increased the expression of endogenous TTP in the U87MG human glioma cells (Figs. 1A and 1B). Currently, one mechanism, which explains the lack of TTP in cancers, has been transcriptional silencing as a result of the hypermethylation of CpG islands extant in the TTP promoter (Young et al., 2009). In many disease processes such as cancer, gene promoter CpG islands are abnormally hypermethylated as a result of a modification of the DNA methyltransferase (DNMT) expression and activity, which results in transcriptional gene silencing (Meeran et al., 2010). Several bioactive dietary components have great potential in altering DNA methylation by altering DNMT levels during cancer prevention and therapy (Li and Tollefsbol, 2010). In previous studies, Res has been shown to have DNMT inhibitory activity. Res interrupted epigenetic silencing of breast cancer-1 (BRCA-1) induced by the aromatic hydrocarbon receptor (AHR) in the MCF-7 human breast cancer cells (Papoutsis et al., 2010; Stefanska et al., 2010). These results suggested that Res treatment increased the expression of endogenous TTP by blocking the epigenetic silencing of TTP by DNMT inhibitory activity. TTP regulated the decay of uPA and uPAR transcripts associated with the invasion and tumor growth in human breast cancer cells (Al-Souhibani et al., 2010). The present study shows that the increased expression of TTP by Res inhibited the expression of uPA and uPAR mRNAs and proteins (Fig. 2A). Furthermore, the expression of Res-induced TTP promoted the decay of uPA and uPAR mRNAs (Fig. 2B). Posttranscriptional regulation of uPA and uPAR mRNA expression was facilitated by the existence of AREs in the 3′UTR of these mRNAs (Nanbu et al., 1994; Roldan et al., 1990). Specifically, Res-induced TTP directly bound to the ARE regions containing the 3′ UTR of uPA and uPAR mRNAs (Figs. 4A and 4B). Overall, the results of the present study show that TTP is a regulator of uPA and uPAR mRNA turnover.
The down-regulation of uPA and uPAR using the antisense adenovirus-mediated constructs in SNB19 glioma cells resulted in decreased migration and invasion, and retarded intracranial tumor growth in nude mice (Gondi et al., 2003). The expression of Res-induced TTP in U87MG cells (Fig. 5A) inhibited cell growth compared with the NHFB cells (Supplementary Fig. S1). The down-regulation of uPA and uPAR expression lead to the dephosphorylation of p-Akt, the activation of caspase-8, and a collapse in the mitochondrial membrane potential as revealed by the release of cytochrome c into the enclosing cytoplasm (Gondi et al., 2007). Together, the results showed that the increased expression of TTP by Res inhibited cell growth through the down-regulation of uPA and uPAR expression in the U87MG cells.
The present study also demonstrated that the expression of Res-potentiated TTP induced apoptosis in the human glioma cells (Figs. 5B?5D). Importantly, the inhibition of TTP by siRNA attenuated the effects of Res on both cell growth (Fig. 6B) and apoptosis (Figs. 6C and 6D). These results indicate that TTP mediated the apoptotic effect of Res on human glioma cells. In many previous studies, TTP has multiple cellular functions, including roles in cell survival, proliferation, differentiation, apoptosis and tumorigenesis. TTP mediated cell-cycle arrest and cell death through regulation of p21/CIP1/WAF-1 (Al-Haj et al., 2012). TTP overexpression also enhances the decay of Pim-1 mRNA by binding to the AU-rich element in its 3′-UTR (Kim et al., 2012). Therefore, TTP directly regulated cell death through decay of p21 mRNA. Furthermore, TTP indirectly regulated cell death through decay of pim1 mRNA. In particular, TTP induced an apoptotic program of cell death in human glioma cells (Suswam et al., 2008). In addition to Res, the other agents such as doxycycline (DOX) also induced the expression of TTP in human cancer cells (Lee et al., 2013). However, it is not known whether TTP induction by other agents involved the same mechanisms therefore further studies are needed to characterize the mechanism mediating TTP expression by diverse agents, including Res.
In summary, the present study demonstrated that Res increased TTP expression in the human glioma cells. The expression of Res-induced TTP were determined to destabilized uPA and uPAR mRNAs by the direct binding to the ARE regions containing the 3′ UTR regions of their mRNAs. Furthermore, the increased expression of TTP by Res suppressed cell growth and induced apoptosis in the human glioma cells. These findings suggest that by regulating TTP expression, several bioactive dietary compounds such as Res can be used as novel anti-cancer agents for the treatment of malignant gliomas.
Jinhyun Ryu, Nal Ae Yoon, Yeon Kyung Lee, Joo Yeon Jeong, Seokmin Kang, Hyemin Seong, Jungil Choi, Nammi Park, Nayoung Kim, Wha Ja Cho, Sun Ha Paek, Gyeong Jae Cho, Wan Sung Choi, Jae-Yong Park, Jeong Woo Park, and Sang Soo Kang
Mol. Cells 2015; 38(2): 156-162 https://doi.org/10.14348/molcells.2015.2259Kwangho Kim, Tae Young Ryu, Jinkwon Lee, Mi-Young Son, Dae-Soo Kim, Sang Kyum Kim, and Hyun-Soo Cho
Mol. Cells 2022; 45(9): 622-630 https://doi.org/10.14348/molcells.2022.0014Dong-Gyu Cho, Sang-Soo Lee, and Kyung-Ok Cho
Mol. Cells 2021; 44(1): 13-25 https://doi.org/10.14348/molcells.2020.0244