
Research Article

Split Viewer

Mol. Cells 2020; 43(7): 607-618

Published online July 31, 2020

© The Korean Society for Molecular and Cellular Biology

Enhancer Function of MicroRNA-3681 Derived from Long Terminal Repeats Represses the Activity of Variable Number Tandem Repeats in the 3’ UTR of SHISA7

Hee-Eun Lee1,2,3 , Sang-Je Park3 , Jae-Won Huh3,4 , Hiroo Imai5 , and Heui-Soo Kim2,6, *

1Department of Integrated Biological Science, Pusan National University, Busan 46241, Korea, 2Institute of Systems Biology, Pusan National University, Busan 46241, Korea, 3National Primate Research Center, Korea Research Institute of Bioscience and Biotechnology, Cheongju 28116, Korea, 4Department of Functional Genomics, Korea Research Institute of Bioscience and Biotechnology (KRIBB) School of Bioscience, Korea University of Science and Technology (UST), Daejeon 34113, Korea, 5Department of Cellular and Molecular Biology, Primate Research Institute, Kyoto University, Inuyama 484-8506, Japan, 6Department of Biological Sciences, College of Natural Sciences, Pusan National University, Busan 46241, Korea

Correspondence to :

Received: March 4, 2020; Revised: May 12, 2020; Accepted: May 27, 2020

microRNAs (miRNAs) are non-coding RNA molecules involved in the regulation of gene expression. miRNAs inhibit gene expression by binding to the 3′ untranslated region (UTR) of their target gene. miRNAs can originate from transposable elements (TEs), which comprise approximately half of the eukaryotic genome and one type of TE, called the long terminal repeat (LTR) is found in class of retrotransposons. Amongst the miRNAs derived from LTR, hsa-miR-3681 was chosen and analyzed using bioinformatics tools and experimental analysis. Studies on hsa-miR-3681 have been scarce and this study provides the relative expression analysis of hsa-miR-3681-5p from humans, chimpanzees, crab-eating monkeys, and mice. Luciferase assay for hsa-miR-3681-5p and its target gene SHISA7 supports our hypothesis that the number of miRNA binding sites affects target gene expression. Especially, the variable number tandem repeat (VNTR) and hsa-miR-3681-5p share the binding sites in the 3’ UTR of SHISA7, which leads the enhancer function of hsa-miR-3681-5p to inhibit the activity of VNTR. In conclusion, hsa-miR-3681-5p acts as a super-enhancer and the enhancer function of hsa-miR-3681-5p acts as a repressor of VNTR activity in the 3′ UTR of SHISA7.

Keywords long terminal repeat, miR-3681-5p, SHISA7, transposable elements, variable number tandem repeat

Transposable elements (TEs) comprise approximately half of the eukaryotic genome and are known to insert into the genome as stable genomic components (Bourque et al., 2018; Wicker et al., 2007). TEs are divided into two classes—retrotransposons (class I) and DNA transposons (class II). Retrotransposons use the ‘copy and paste’ mechanism. The retrotransposons are first transcribed into an RNA intermediate, which is reverse transcribed into a DNA intermediate (Agren and Clark, 2018; Bourque et al., 2018; Lander et al., 2001; Wicker et al., 2007). Long terminal repeat (LTR) is a member of the retrotransposon family and the composition of LTR in humans is approximately 9%. An LTR consists of innate enhancer activity, however, transcription factor (TF), nucleotide substitutions, transcription start sites, and epigenetics may provide alternative enhancer activity of LTR elements (Thompson et al., 2016). LTRs recruit TF and enhance the transcription of host genes (Gonzalez-Cao et al., 2016; Hu et al., 2017). TEs can generate regulators of genes, such as microRNAs (miRNAs), TFs, and variable number tandem repeats (VNTRs) (Feschotte, 2008; Lee et al., 2019; Piriyapongsa et al., 2007; Qin et al., 2015; Roberts et al., 2014; Sabino et al., 2014).

miRNAs are small non-coding RNA molecules, approximately 19 to 24 nucleotides long, which are essential for gene regulation (Ambros et al., 2003; Bartel, 2004; Kim, 2005; O'Brien et al., 2018). miRNAs have a unique seed region, approximately six nucleotides long, that binds to the 3′ untranslated region (UTR) of the target mRNA. In most of cases, miRNAs regulate gene expression by inhibiting gene expression; however, recent study has reported the presence of enhancer miRNAs (Lee et al., 2019). In addition, some miRNAs bind to the 5′ UTR of the target transcripts and to coding sequences, to regulate target gene expression (Brummer and Hausser, 2014; Gu et al., 2014; Hausser et al., 2013; Lee et al., 2009; Li et al., 2016; Liu et al., 2015). In studies on miRNA, the number of miRNA binding sites in the target gene was not an important consideration in selecting the best target genes. Previous studies have suggested that miRNAs derived from transposable element (MDTE) and MDTEs share sequences (Lee et al., 2019; Petri et al., 2019; Piriyapongsa and Jordan, 2007; Piriyapongsa et al., 2007; Qin et al., 2015; Roberts et al., 2014). Hsa-miR-3681 is derived from an LTR element and has not been studied much. A few studies on hsa-miR-3681 have reported on its dysregulation in human disease and cancer and downregulation in cervical cancer (Shi et al., 2019; Vaira et al., 2014; Vaz et al., 2010).

One of target genes for hsa-miR-3681-5p, SHISA7, is a regulator of long-term synaptic potentiation, and plays an important role in regulating the neurotransmitter of gamma‐aminobutyric acid (Han et al., 2019). A few reports have predicted that SHISA7 is an miRNAs target and one study has reported that miRNA downregulates SHISA7 expression in neuroblastoma cells (Cai et al., 2018; Marques et al., 2012; Yamamura et al., 2018). The 3′ UTR of SHISA7 includes VNTRs, which are organized into 10 to 100 bp tandem repeats and often shows variations in the number of repeats among individuals (Nakamura et al., 1987). Previous reports have suggested that the VNTR in the 3′ UTR of the human dopamine transporter (DAT) regulates the expression of DAT (Inoue-Murayama et al., 2002). Another study has shown that the 3′ UTR can act as a regulator and enhancer to induce transcription (Jash et al., 2012).

In this study, the relative expression of the MDTEs, hsa-miR-3681-5p and its target SHISA7, was profiled in human, chimpanzee, crab-eating monkey, and mouse to compare its relative expression in evolutionary terms. Another aim of this study was to evaluate the impact of the number of miRNA binding sites on the regulation of target gene expression. In addition, the role of VNTR, with conserved hsa-miR-3681-5p seed region, in the 3′ UTR of SHISA7 is discussed for further studies.

Ethical statement

Experiments with the Western chimpanzee were carried out in accordance with the guidelines and regu­lations approved by the Animal Experimentation Committees of Kyoto University (2018-004). Experiments with Crab-eating monkey were carried out in accordance with guidelines and regulation approved by Korea Research Institute of Bioscience & Biotechnology (KRIBB-AEC-15046).

Bioinformatic analyses

The sequence of hsa-miR-3681-5p was downloaded from miRbase v22.1 ( (Kozomara et al., 2019), and then the sequence was used to localized in human genome (GRCh38) and to download sequence of LTR16D1 by UCSC Genome Browser ( (Agarwal et al., 2015). The sequences of hsa-miR-3681-5p and LTR16D1 were aligned using BioEdit ( (Hall, 1999) to compare the analogy. TargetScanHuman ( (Agarwal et al., 2015) was used to list out the target gene candidates of hsa-miR-3681-5p (Table 1).

The structural interaction between hsa-miR-3681-5p and the 3′ UTR of SHISA7 was generated using BiBiServ RNAhybrid ( (Rehmsmeier et al., 2004). BiBiServ RNAhybrid is used to predict target genes and analyze the minimum free energy values, which represent the score of binding affinity between the miRNA and the target gene. The sequences of SHISA7 and hsa-miR-3681-5p were used to detect complementary binding sites of hsa-miR-3681-5p in the 3′ UTR of SHISA7. Primers were designed using Primer3 v 4.1 ( (Koressaar et al., 2018) (Table 2).

The putative TF binding sites near the 9.5 VNTRs of the 3′ UTR of SHISA7 was predicted using MATCH in TRANSFAC v8.0 ( (Kel et al., 2003; Wingender et al., 2001). Threshold values greater than 0.98 in both core match and matrix match were used for the prediction. Matrix match indicates the quality of the match between a matrix and a random part of the input sequence. Core match determines the quality of a match between the core sequences of a matrix.

Human and animal samples

Total RNAs from 13 human tissues (brain, heart, lung, liver, kidney, spleen, stomach, small intestine, colon, muscle, testis, prostate, and uterus) and 10 mouse tissues (brain, heart, lung, liver, kidney, spleen, stomach, smooth muscle, testis, and spinal cord) were purchased from Clontech (USA).

A total of 14 female crab-eating monkey tissue samples (cerebellum, cerebrum, heart, lung, liver, kidney, spleen, stomach, small intestine, large intestine, uterus, pancreas, bladder, and spinal cord) were provided by the National Primate Research Center (Korea). Total RNA was extracted from 14 tissue samples of the female crab-eating monkey by using Hybrid-RTM (GeneAll, Korea), according to the manufacturer’s instructions.

Tissue samples from the female Western chimpanzee were provided from the Kumamoto sanctuary, Kyoto University, to Primate Research Institute in Inuyama, Japan, via GAIN and the male Western chimpanzee samples were provided by the Primate Research Institute. All experiments using samples from the Western chimpanzee were done at the Primate Research Institute. Total RNA was extracted from 11 tissues of healthy male Western chimpanzees (cerebellum, heart, lung, liver, kidney, spleen, stomach, small intestine, colon, muscle, and testis) and female Western chimpanzees (cerebellum, heart, lung, liver, kidney, spleen, stomach, small intestine, colon, muscle, and ovary) by using Hybrid-RTM, according to the manufacturer’s instructions.

The RNA samples were quantitated using the ND-1000 UV-Vis spectrophotometer (NanoDrop, USA). A total of 500 ng of quantified RNA was reverse transcribed from mRNA by using PrimeScript RT Reagent Kit with gDNA Eraser (TaKaRa, Japan) and from miRNA by using HB miR Multi Assay KitTM system Ⅰ (HeimBiotek, Korea).

Quantitative polymerase chain reaction amplification

The quantitative polymerase chain reaction (qPCR) primer information for SHISA7 and the reference gene is listed in Table 2. cDNA samples from humans, male and female Western chimpanzees, female crab-eating monkeys, and male mice were used with the SYBR Green Q-PCR Master Mix with High Rox (SmartGene, Korea) for qPCR, according to the manufacturer’s instructions in a Rotor-Gene Q system (Qiagen, Germany), under the following qPCR conditions; initialization step at 95°C for 2 min, followed by 45 thermal cycles of 95°C for 5 s, 55°C for 10 s, and 72°C for 15 s; standard melting conditions of the ramp ranged from 55°C to 99°C, with a 1°C rise at each step. Glyceraldehyde 3-phosphate dehydrogenase (G3PDH) was used as the reference gene for the normalization of relative expression analysis for SHISA7. All samples were amplified in triplicates, and the relative expression data was analyzed according to the 2-ΔC t method, where ΔCt = Ct (SHISA7) – Ct (G3PDH). All the bar in the graphs were plotted as the mean ± SD.

The miRNA level cDNA samples in human, male and female Western chimpanzee, female crab-eating monkey, and male mouse were used with the HB_I Real-Time PCR Master mix kit (HeimBiotek) to perform qPCR, according to the manufacturer’s protocol in a Rotor-Gene Q system, under the following qPCR conditions; initialization step at 95°C for 2 min, followed by 45 thermal cycles of 95°C for 5 s, 55°C for 10 s, and 72°C for 15 s; standard melting conditions of the ramp ranged from 55°C to 99°C, with a 1°C rise at each step. Small nuclear RNA (snRNA) U6 was used as the reference gene for normalization of relative expression analysis for miR-3681-5p (5′-UAGUGGAUGAUGCACUCUGUGC-3′). All samples were amplified in triplicates, and the relative expression data was analyzed according to the 2-ΔC t method, where ΔCt = Ct(hsa-miR-3681-5p) – Ct(U6). All the bar in the graphs were plotted as the mean ± SD.

Genomic DNA extraction and gene cloning

Genomic DNA was extracted from a human cell line HEK293A using DNeasy Blood & Tissue Kit (Qiagen), according to the manufacturer’s protocol. Genomic DNA was then used for PCR amplification using the primer list shown in Table 2. The 20 µl PCR mix contained 10 µl of 2× TOPsimple DyeMix (aliquot)-HOT premix (Enzynomics, Korea), 7 µl of distilled water, 1 µl of gDNA template, and 1 µl of forward and reverse primers (10 pmole/µl) each. PCR conditions were as follows: initialization step at 95°C for 5 min, followed by 35 thermal cycles of 94°C for 40 s, annealing temperatures listed in Table 2 for 40 s, 72°C 40 s, and the final elongation step at 72°C 5 min. The PCR products were separated on a 1.5% agarose gel, and purified with ExpinTM Gel SV (GeneAll), according to the manufacturer’s protocol. The purified PCR products were cloned into a psi-CHECK2 vector (Promega, USA) using the LigaFastTM Rapid DNA Ligation System (Promega), as per the manufacturer’s protocol. The cloned plasmid DNA was isolated by using ExprepTM Plasmid SV, mini (GeneAll).

Cell culture and luciferase assay

The lung cancer derived cell line A549 was grown at 37°C in a 5% (v/v) CO2 incubator at Rosewell Park Memorial Institute (RPMI) (Gibco, USA), supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS) (Gibco), and 1% (v/v) antibiotic-antimycotic (Gibco). The cells were plated in 24-well plates at a cell-density of 1 × 105 cells/well and grown to 80% confluence. After 24 h of incubation at 37°C in a 5% (v/v) CO2 incubator, the cells were transfected with psi-CHECK2 vector cloned with different SHISA7 regions and miRNA mimics. A total of 500 ng of plasmid vector and 100 µM of mimics were used during cell transfection. Co-transfection was done using jetPRIME® (Polyplus, France), under the manufacturer’s instructions. After 24 h of incubation at 37°C in a 5% (v/v) CO2 incubator, the cells were lysed using 1× passive buffer (Promega), as per the manufacturer’s protocol, followed by incubation in –80°C deep freezer for over 3 h. Firefly and Renilla luciferase activities were assessed using the Dual-Luciferase® Reporter Assay System (Promega), according to the manufacturer’s instructions. Lane 1 was transfected with only the plasmid vector of each SHISA7 region, lane 2 was co-transfected with plasmid vector containing miRNA negative control (Bioneer, Korea), lane 3 was co-transfected with plasmid vector containing miR-3681 mimic (Bioneer), lane 4 was co-transfected with plasmid vector containing miR-3681-5p inhibitor mimic (Bioneer), and lane 5 was co-transfected with plasmid vector containing both miR-3681 mimic and miR-3681-5p inhibitor mimic. The negative control mimic is made up of scrambled miRNAs; miR-3681 mimic is a chemically synthesized double-stranded RNA oligonucleotide and miR-3681-5p inhibitor is a single-stranded synthetic inhibitor with target miRNA complementary binding sequence. Each experiment was performed in triplicates and data is presented with bars as the mean ± SD. The Student’s t-test in Excel 2016 (Microsoft, USA) was used to determine the significance of the results (*P < 0.08, **P < 0.06, ***P < 0.04).

Long terminal repeats derived microRNA-3681

The sequence of hsa-miR-3681-5p (5′-UAGUGGAUGAUGCACUCUGUGC-3′) was downloaded from miRbase v22.1 and used for blast search using the UCSC genome browser (GRCh38), to confirm the location and the nearest gene in human chromosomes. The seed region of hsa-miR-3681-5p is 5′-AGUGGAU-3′ and hsa-miR-3681 is present in the p arm of human chromosome 2. Moreover, hsa-miR-3681 overlaps with LTR16D1. The sequence of LTR16D1 was downloaded from the UCSC genome browser to determine the analogy between target miRNA and its derived gene (Fig. 1). The alignment result shows that hsa-miR-3681-5p is derived from LTR16D1, as seen from the perfectly matched sequence.

Bioinformatic analyses of hsa-miR-3681-5p and SHISA7

The target gene list of hsa-miR-3681-5p was downloaded from Target Scan Human and the candidates were selected based on the highest number of total seed sites that are complementary to the 3′ UTR of the target gene (Table 1). Out of 2,424 target genes, 13 were selected from the list and SHISA7 showed the highest number of total seed sites and 8-mer hsa-miR-3681-5p binding sites in the 3′ UTR.

The schematic structure of SHISA7 shows that it is inserted inversely in chromosome 19 of humans and that there are three CpG islands that cover the 5′ UTR, exon 2, and 3′ UTR, respectively (Fig. 2A). The CpG island on both UTRs are fully covered; however, the one on exon 2 is partially covered. The 3′ UTR of SHISA7 contains a six 9-mer and two 8-mer hsa-miR-3681-5p complementary binding site (Supplementary Fig. S1). Using BiBiServ RNAhybrid, the structural interaction between hsa-miR-3681-5p and 3′ UTR of SHISA7 was observed (Fig. 2B). The minimum free energy value between hsa-miR-3681-5p and SHISA7 is –26.4 kcal/mol. The seed region of hsa-miR-3681-5p is well conserved when RNA hybrid with the 3′ UTR of SHISA7.

Three primers were designed from the 3′ UTR of SHISA7 to examine if difference in expression is related to the number of 9-mer hsa-miR-3681-5p (Table 2). Primer #1, #2, and #3 have one, three, and six, 9-mer binding sites of hsa-miR-3681-5p in the 3′ UTR of SHISA7, respectively.

Relative expression analyses of hsa-miR-3681-5p and SHISA7 in human, male and female Western chimpanzee, female crab-eating monkey, and male mouse tissues

Relative expression analyses of hsa-miR-3681-5p and SHISA7 was done by qPCR and re-analyzed using Heatmapper. The heatmap of relative expression of hsa-miR-3681-5p showed ubiquitous expression in human tissues; however, the values were under 0.004 (Fig. 3A). The muscles showed the highest, whereas the spleen and the lung the lowest, in humans. The male and female Western chimpanzees also showed low relative expression values of hsa-miR-3681-5p. For the male and female Western chimpanzees, the expression in the kidney and the small intestine was the highest (Figs. 3B and 3C), respectively. Interestingly, the female crab-eating monkeys showed high relative expression in the spinal cord with a value of over 0.12, whereas other tissues showed expression values lower than 0.02 (Fig. 3D). The heatmap of relative expression of hsa-miR-3681-5p in the male mice showed highest expression in the liver and the kidney; however, the value was between 0.0004 and 0.0005 (Fig. 3E). Lowest expression of hsa-miR-3681-5p was seen in the spleen of mice. A 9-mer hsa-miR-3681-5p binding site, in the 3′ UTR of SHISA7, showed expression in the stomach and the small intestine of humans; however, other tissues did not (Fig. 3A). The same 9-mer binding primer is relatively high in the testis, stomach, and cerebellum of the male Western chimpanzees (Fig. 3B), cerebellum of the female Western chimpanzees (Fig. 3C), and the bladder of the crab-eating monkeys (Fig. 3D). The male mice showed a higher expression value than hsa-miR-3681-5p, with the highest value of approximately 0.015 in the spleen and the lowest, approximately 0.002, in the kidney and the brain; both results being opposite, compared to hsa-miR-3681-5p (Fig. 3E). The three 9-mer hsa-miR-3681-5p binding site in the 3′ UTR of SHISA7 showed highest relative expression in the brain of humans (Fig. 3A), the stomach and testis of the male Western chimpanzees (Fig. 3B), the cerebellum of the female Western chimpanzees (Fig. 3C), the bladder of the female crab-eating monkeys (Fig. 3D), and the spleen of the male mice (Fig. 3E). The three 9-mer binding sites in the 3′ UTR of SHISA7 showed similar results to one 9-mer binding site in SHISA7; however, the expression value was greater in all samples.

Except for humans, the relative expression results for the female and male Western chimpanzees, crab-eating monkeys, and mice showed similar patterns for 9-mer hsa-miR-3681-5p binding sites. The male Western chimpanzees had the highest relative expression in the testis and the stomach for both one 9-mer hsa-miR-3681-5p binding primers (Fig. 3B). The female Western chimpanzees had the highest relative expression in the cerebellum for both 9-mer hsa-miR-3681-5p binding primers (Fig. 3C). The female crab-eating monkeys had the highest relative expression in the bladder for both primers (Fig. 3D). The male mice had the highest relative expression in the spleen and the lowest relative expression in the kidney and the brain, for both primers (Fig. 3E). The relative expression data in graph of all hsa-miR-3681-5p and primers are shown in Supplementary Figs. S2-S6.

The luciferase analysis of hsa-miR-3681-5p and SHISA7

To analyze the correlation between the 3′ UTR of SHISA7 and the number of 9-mer hsa-miR-3681-5p binding sites, the lung cancer derived cell line, A549, was used for co-transfection (Fig. 4). The result of one 9-mer for hsa-miR-3681-5p did not show any significant outcome. The result showed that, compared to control and the negative control, three and six 9-mer hsa-miR-3681-5p binding primers showed enhancer activity when hsa-miR-3681 mimic treatment was done. In contrast, the activity decreased when hsa-miR-3681-5p inhibitor was used. Interestingly, when the hsa-miR-3681 mimic and hsa-miR-3681-5p inhibitor are used together, the activity of three and six 9-mer hsa-miR-3681-5p binding plasmid enhanced approximately one and a half to two-fold more than when hsa-miR-3681 mimic was used alone.

The prediction of transcription factors in 3′ UTR of SHISA7

The 3′ UTR of SHISA7 sequence was examined using TRANSFAC v8.0 with the assumption that the enhancer activity of SHISA7, with three and six 9-mer hsa-miR-3681, was in co-operation with TF. A total of 44 TF binding sites, with thresholds of over 1 for core match and over 0.98 for matrix match, were found in the 3′ UTR of SHISA7.

The prediction and impact of VNTRs in the 3′ UTR of SHISA7

The sequence and name of the TFs near hsa-miR-3681-5p 9-mer seed regions are indicated within the box in Fig. 5. The prediction of TF provided the possibility of VNTR in the 3′ UTR of SHISA7.

The schematic structure of SHISA7 and its sequence shows a detailed understanding of VNTRs in the 3′ UTR (Fig. 6A). The predicted VNTRs were aligned using BioEdit to determine the sequences (Fig. 6B). Interestingly, nine complete and one half of VNTR sequences were obtained near the 9-mer hsa-miR-3681-5p binding sites in the 3′ UTR of SHISA7. Six 9-mer hsa-miR-3681-5p binding sites were well conserved in VNTRs and except for a few unpaired sequences; approximately 70 to 75 sequences were present in the full VNTRs and approximately 25 to 30 nucleotides in the half VNTR.

This study focused on the idea that the number of miRNA binding sites in the 3′ UTR of a target gene will affect its expression. For evolutionary profiling, examination of the relative expression analysis on MDTE hsa-miR-3681-5p was performed by qPCR in the target gene of hsa-miR-3681-5p SHISA7, in human, chimpanzee, crab-eating monkey, and mouse. This analysis provided an understanding on how MDTE hsa-miR-3681-5p acted as an enhancer and blocked the activity of the VNTR.

SHISA7 is a well-known brain and neurotransmitter related gene; however, actual molecular biological studies on SHISA7 are scarce (Cai et al., 2018; Han et al., 2019; Schmitz et al., 2017). Moreover, there is lack of studies on hsa-miR-3681-5p. Therefore, collecting data on hsa-miR-3681-5p and SHISA7 has proven to be difficult. In our analysis, the heatmap showed that the relative expression value of hsa-miR-3681-5p was highest in the spinal cord of the crab-eating monkey and the value of hsa-miR-3681-5p was low in humans, chimpanzees, and mice (Fig. 3). The relative expression results with one and three 9-mer hsa-miR-3681-5p binding sites in the 3′ UTR of SHISA7 showed an interesting pattern in chimpanzees, monkeys, and mice. The result from male and female chimpanzees, monkeys, and mice showed approximately two-fold higher expression value in the three 9-mer hsa-miR-3681-5p binding region than one 9-mer hsa-miR-3681-5p. The relative expression in humans did not show any distinguishing patterns; however, the expression of three 9-mer hsa-miR-3681-5p binding region in SHISA7 increased greatly compared with one 9-mer hsa-miR-3681-5p binding primer. SHISA7 is known as a brain related gene and human data shows that binding number of 9-mer hsa-miR-3681-5p is essential for relative expression. The product size of both primers was approximately 160 bp and the size of the primers did not affect the value of relative expression. Previously, SHISA7 was shown to be a regulator of neurotransmitters and the species-based comparison of relative expression shows that humans and male and female chimpanzees have a similar pattern in the brain samples. The relative expression value was low in hsa-miR-3681-5p; however, the expression value for three hsa-miR-3681-5p binding region the in 3′ UTR of SHISA7 was higher.

We hypothesized that the number of 9-mer hsa-miR-3681-5p binding sites affects the relative expression data and the luciferase assay. Previously, a miRNA study reported that miR-185 downregulates the expression of SHISA7 in human and mouse neuroblastoma cells (Marques et al., 2012). In the case of hsa-miR-3681-5p, the plasmid with one of 9-mer hsa-miR-3681-5p binding site did not show any significant result; however, the plasmid with three and six 9-mer hsa-miR-3681-5p binding sites showed similar patterns. Instead of downregulating the SHISA7, the plasmid with three and six 9-mer hsa-miR-3681-5p binding regions up regulated the expression of SHISA7, in the presence of the hsa-miR-3681 mimic. In the presence of the hsa-miR-3681-5p inhibitor, the expression decreased more than the control. Interestingly, when both mimic and inhibitor were, the activity was upregulated, compared to the mimic treatment alone. The prediction was that since miRNA mimic is composed of double-stranded RNA oligonucleotides of the target miRNA, hsa-miR-3681-3p must be affecting SHISA7, however, complementary binding sites for hsa-miR-3681-3p are not present in the 3′ UTR of SHISA7. To discover the enhancer activity in both the miRNA mimic and the inhibitor treated lane, the sequence of 3′ UTR SHISA7 was analyzed and various TFs and VNTRs were seen to be included in the 3′ UTR of SHISA7. A total of nine and a half VNTRs existed and TFs in VNTR were present with their own patterns. TF MEIS1 was predicted near the seed region of five hsa-miR-3681-5p binding site and three TF GATA-1 was predicted near the 1st, 8th, and 9th VNTR start sites. The threshold of both core match and matrix match was set to 0.95 to check if there are missing GATA-1; however, TF prediction did not include more GATA-1. However, OF-miRNA-307 study provided the possibility that the TF near the binding site of miRNA in the 3′ UTR of the target gene might have a chance to cooperate with miRNA to gain enhancer activity (Lee et al., 2019).

Another diagnosis of enhancer activity shown in both hsa-miR-3681 mimic and hsa-miR-3681-5p inhibitor is VNTRs. VNTR and miRNA studies are scarce; however, a few studies have been done on brain disease related genes. A study analyzed autism and neurotransmitter related genes and miRNAs; MAOA, MAOB, DRD2, miRNA-431, and -21 for genomic sequence variations (Salem et al., 2013). Another study revealed that VNTRs regulate miRNA-137 by alternative splicing and this event increases the risk of schizophrenia (Pacheco et al., 2019). The deletion form of miRNA-137 transcripts is more frequent when an increased number of VNTRs were detected. Similar to our report, one of the reports used the luciferase assay to check VNTR and miRNA-491 expression (Jia et al., 2016). The result shows that when miRNA-491 mimic treatment was done with different number of VNTR copies, the expression was downregulated when more copies of VNTRs were included. In contrast, the expression was upregulated when anti-miRNA-491 was treated to different quantities of VNTR copies. In our report, the both hsa-miR-3681 mimic and hsa-miR-3681-5p inhibitor treatment result shows upregulation in all luciferase assays. The promoter activity is different within the length of VNTRs in the LTR12C element and it affects the expression of RAE1 by cooperating with TF, NF-Y (Jung et al., 2017). The hypothesis was that miRNA affects VNTR by repressing the activity; in rare cases VNTRs gain enhancer activity by blocking hsa-miR-3681 mimics by hsa-miR-3681-5p inhibitor. In other words, we assume that VNTRs help hsa-miR-3681-5p to gain enhancer activity; however, the activity of VNTR might be repressed more than it should be by hsa-miR-3681-5p.

The illustration of the summary of this study can be seen in Fig. 7. miRNA derived from LTR or any of the TEs, called MDTEs, binds to the 3′ UTR of the target gene. In some cases, the 3′ UTR of target gene contains VNTRs such as SHISA7 gene and this study provides the possibility that MDTE may enhances the gene expression, but its enhancer activity may represses the activity of VNTR. The MDTE recruits alternative enhancer and promoter, activators, mediators, TFs, and RNA Pol II to function as an enhancer. The relative expression data confirmed that the number of miRNA binding sites is important for miRNA activity in the 3′ UTR of the target gene. Another evidence that miRNAs or MDTEs can function as enhancers is their ability to repress the activity of VNTRs. Further studies are needed to confirm that the enhancer activity of both hsa-miR-3681 mimic and hsa-miR-3681-5p inhibitor is contributed by VNTRs or TFs.

This research was supported by the Cooperative Research Program of Primate Research Institute, Kyoto University (2019-B-7) and the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2018R1D1A1B07049460). We thank Kumamoto sanctuary and Primate Research Institute in Inuyama, Japan for providing the samples of Western chimpanzee male and female samples.

H.E.L. designed and performed all the experiments including writing the manuscript, J.W.H. and S.J.P. provided the crab-eating monkey samples, H.I. provided the Western chimpanzee samples, and H.S.K. commented and revised the manuscript.

Fig. 1. The alignment result of LTR-LTR16D1 and hsa-miR-3681-5p. The black box shows the conserved region of hsa-miR-3681-5p and LTR16D1. The sequence of hsa-miR-3681-5p is shown under the alignment and the seed region is in bold.
Fig. 2. Bioinformatics analysis of hsa-miR-3681-5p and its target gene SHISA7. (A) Schematic structure of SHISA7 and the alignment result. The coding sequences are in black and the untranslated regions (UTRs) are in dark grey. Three CpG islands are present in SHISA7, and one each of the CpG island is covering the 5′ UTR, exon 2, and the 3′ UTR. CpG islands are shown in light grey. In the 3′ UTR of SHISA7, a total of six 9-mer binding sites of hsa-miR-3681-5p exist and from the sequence nine seeds of hsa-miR-3681-5p is shown in the black box. (B) RNA hybrid of hsa-miR-3681-5p and SHISA7. The seed region of hsa-miR-3681-5p and complementary binding site in the 3′ UTR of SHISA7 is shown in the grey box. The minimum free energy value between hsa-miR-3681-5p and 3′ UTR of SHISA7 is –26.4 kcal/mol. The light green represents hsa-miR-3681-5p and red represents the 3’ UTR of SHISA7.
Fig. 3. Relative expression analyses of hsa-miR-3681-5p and SHISA7 by heatmapper. (A) Heatmap of relative expression of hsa-miR-3681-5p and two primers of SHISA7 in humans. (B) Heatmap of relative expression on hsa-miR-3681-5p and two primers of SHISA7 in male Western chimpanzee. (C) Heatmap of relative expression on hsa-miR-3681-5p and two primers of SHISA7 in female Western chimpanzee. (D) Heatmap of relative expression on hsa-miR-3681-5p and two primers of SHISA7 in female crab-eating monkey. Crab-eating monkey is shortened as CEM. (E) Heatmap of relative expression on hsa-miR-3681-5p and two primers of SHISA7 in male mouse.
Fig. 4. Luciferase analysis of hsa-miR-3681-5p and SHISA7 in A549 cell. The information on each color of the bar is provided at the top of the graph. All the bar in the graphs were plotted as the mean ± SD. The Student’s t-test was used to determine the significance of the results. *P < 0.08, **P < 0.06, ***P < 0.04.
Fig. 5. Prediction of TF binding sites and VNTR in the 3′ UTR of SHISA7. Each predicted VNTR is divided with dotted boxes. The predicted TFs are in black boxes with the name of each TF and the 9-mer hsa-miR-3681-5p binding sites are in bold black lines.
Fig. 6. Predicted VNTR regions in 3' UTR of SHISA7. (A) The schematic structure of VNTR in the 3′ UTR of SHISA7. The sequence of two white dotted lines, in the schematic structure of the 3′ UTR of SHISA7, is shown under the structure. Red bold lines represent the seed region of hsa-miR-3681-5p, and the dotted boxes in the sequence represent each VNTRs. Nine complete VNTRs and one half of VNTR sequences are seen. (B) The alignment of predicted VNTR in the 3′ UTR of SHISA7. A dot represents the identical nucleotide of the first sequence and a missing nucleotide is marked with a swung dash (~) or a hyphen (-). The grey box represents the conserved seed region of hsa-miR-3681-5p.
Fig. 7. Schematic illustration of overall summarization on enhancer activity of VNTR in 3’ UTR of SHISA7 repressed by hsa-miR-3681.
Table 1.

The list of target gene candidates of hsa-miR-3681-5p

Gene nameAbbreviationCoordinatesTranscript IDTotal sites8mer7mer-m87mer-A16mer
Shisa family member 7SHISA7chr19:55,428,738-55,442,863ENST00000376325.4128223
ADP-ribosylation factor-like 10ARL10chr5:176,365,373-176,381,963ENST00000310389.540222
Solute carrier family 8 (sodium/calcium exchanger), member 2SLC8A2chr19:47,428,017-47,471,893ENST00000236877.670074
Zinc finger and BTB domain containing 37ZBTB37chr1:173,868,082-173,903,547ENST00000367701.540402
K(lysine) acetyltransferase 7KAT7chr17:49,788,681-49,835,026ENST00000259021.440225
Glutamate receptor, ionotropic, N-methyl D-aspartate 2BGRIN2Bchr12:13,537,337-13,980,356ENST00000609686.152125
Lysine (K)-specific demethylase 5AKDM5Achr12:280,057-389,320ENST00000399788.250324
RNA binding motif protein 28RBM28chr7:128,297,685-128,343,908ENST00000223073.241124
Neuronal growth regulator 1NEGR1chr1:71,395,943-72,282,539ENST00000357731.541214
Zinc finger and BTB domain containing 20ZBTB20chr3:114,304,949-115,155,228ENST00000462705.140313
Peroxisomal biogenesis factor 26PEX26chr22:18,077,990-18,105,396ENST00000329627.741300
Peptidylprolyl isomerase (cyclophilin)-like 4PPIL4chr6:149,504,495-149,546,043ENST00000340881.240313

SHISA7, shown in bold, was selected as the hsa-miR-3681-5p target gene. Each column shows the name of the target gene, abbreviation of the gene name, the coordinates in the human chromosome, transcript ID, total hsa-miR-3681-5p binding sites in the 3′ UTR, number of binding sites for 8-mer, number of binding sites for 7-mer-m8, number of binding sites for 7-mer-A1, and number of binding sites for 6-mer.

Table 2.

The list of primer information on SHISA7 and the reference gene

PrimerSequencesTemperature (°C)Details
9mer1F: CATCTCCAGGGATCCACTTC55One 9mer hsa-miR-3681-5p in 3’ UTR of SHISA7
9mer3F: AGGATCCACGAGAGCCAAT59Three 9mer hsa-miR-3681-5p in 3’ UTR of SHISA7
9mer6F: CACTACCTCCCAGTATCCA55Six 9mer hsa-miR-3681-5p in 3’ UTR of SHISA7
G3PDHF: GAA ATC CCA TCA CCA TCT TCC AGG55The reference gene; Glyceraldehyde 3-phosphate dehydrogenase (G3PDH)

Each primer was designed based on the quantity of 9mer hsa-miR-3681-5p binding sites. The name of the primer, sequence of each forward (F) and reverse (R) primer, annealing temperature and details about the primer is shown in the table.

  1. Agarwal V., Bell G.W., Nam J.W., and Bartel D.P. (2015). Predicting effective microRNA target sites in mammalian mRNAs. Elife 4, e05005.
    Pubmed KoreaMed CrossRef
  2. Agren J.A. and Clark A.G. (2018). Selfish genetic elements. PLoS Genet. 14, e1007700.
    Pubmed KoreaMed CrossRef
  3. Ambros V., Bartel B., Bartel D.P., Burge C.B., Carrington J.C., Chen X., Dreyfuss G., Eddy S.R., Griffiths-Jones S., and Marshall M., et al. (2003). A uniform system for microRNA annotation. RNA 9, 277-279.
    Pubmed KoreaMed CrossRef
  4. Bartel D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.
    Pubmed CrossRef
  5. Bourque G., Burns K.H., Gehring M., Gorbunova V., Seluanov A., Hammell M., Imbeault M., Izsvak Z., Levin H.L., and Macfarlan T.S., et al. (2018). Ten things you should know about transposable elements. Genome Biol. 19, 199.
    Pubmed KoreaMed CrossRef
  6. Brummer A. and Hausser J. (2014). MicroRNA binding sites in the coding region of mRNAs: extending the repertoire of post-transcriptional gene regulation. Bioessays 36, 617-626.
    Pubmed CrossRef
  7. Cai H., Zhu X.X., Li Z.F., Zhu Y.P., and Lang J.H. (2018). MicroRNA dysregulation and steroid hormone receptor expression in uterine tissues of rats with endometriosis during the implantation window. Chin. Med. J. (Engl). 131, 2193-2204.
    Pubmed KoreaMed CrossRef
  8. Feschotte C. (2008). Transposable elements and the evolution of regulatory networks. Nat. Rev. Genet. 9, 397-405.
    Pubmed KoreaMed CrossRef
  9. Gonzalez-Cao M., Iduma P., Karachaliou N., Santarpia M., Blanco J., and Rosell R. (2016). Human endogenous retroviruses and cancer. Cancer Biol. Med. 13, 483-488.
    Pubmed KoreaMed CrossRef
  10. Gu W., Xu Y., Xie X., Wang T., Ko J.H., and Zhou T. (2014). The role of RNA structure at 5' untranslated region in microRNA-mediated gene regulation. RNA 20, 1369-1375.
    Pubmed KoreaMed CrossRef
  11. Hall T.A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95-98.
  12. Han W., Li J., Pelkey K.A., Pandey S., Chen X., Wang Y.X., Wu K., Ge L., Li T., and Castellano D., et al. (2019). Shisa7 is a GABAA receptor auxiliary subunit controlling benzodiazepine actions. Science 366, 246-250.
    Pubmed KoreaMed CrossRef
  13. Hausser J., Syed A.P., Bilen B., and Zavolan M. (2013). Analysis of CDS-located miRNA target sites suggests that they can effectively inhibit translation. Genome Res. 23, 604-615.
    Pubmed KoreaMed CrossRef
  14. Hu T., Pi W., Zhu X., Yu M., Ha H., Shi H., Choi J.H., and Tuan D. (2017). Long non-coding RNAs transcribed by ERV-9 LTR retrotransposon act in cis to modulate long-range LTR enhancer function. Nucleic Acids Res. 45, 4479-4492.
    Pubmed KoreaMed CrossRef
  15. Inoue-Murayama M., Adachi S., Mishima N., Mitani H., Takenaka O., Terao K., Hayasaka I., Ito S., and Murayama Y. (2002). Variation of variable number of tandem repeat sequences in the 3′-untranslated region of primate dopamine transporter genes that affects reporter gene expression. Neurosci. Lett. 334, 206-210.
  16. Jash A., Yun K., Sahoo A., So J.S., and Im S.H. (2012). Looping mediated interaction between the promoter and 3' UTR regulates type II collagen expression in chondrocytes. PLoS One 7, e40828.
    Pubmed KoreaMed CrossRef
  17. Jia X., Wang F., Han Y., Geng X., Li M., Shi Y., Lu L., and Chen Y. (2016). miR-137 and miR-491 negatively regulate dopamine transporter expression and function in neural cells. Neurosci. Bull. 32, 512-522.
    Pubmed KoreaMed CrossRef
  18. Jung Y.D., Lee H.E., Jo A., Hiroo I., Cha H.J., and Kim H.S. (2017). Activity analysis of LTR12C as an effective regulatory element of the RAE1 gene. Gene 634, 22-28.
    Pubmed CrossRef
  19. Kel A.E., Gossling E., Reuter I., Cheremushkin E., Kel-Margoulis O.V., and Wingender E. (2003). MATCH: a tool for searching transcription factor binding sites in DNA sequences. Nucleic Acids Res. 31, 3576-3579.
    Pubmed KoreaMed CrossRef
  20. Kim V.N. (2005). MicroRNA biogenesis: coordinated cropping and dicing. Nat. Rev. Mol. Cell Biol. 6, 376-385.
    Pubmed CrossRef
  21. Koressaar T., Lepamets M., Kaplinski L., Raime K., Andreson R., and Remm M. (2018). Primer3_masker: integrating masking of template sequence with primer design software. Bioinformatics 34, 1937-1938.
    Pubmed CrossRef
  22. Kozomara A., Birgaoanu M., and Griffiths-Jones S. (2019). miRBase: from microRNA sequences to function. Nucleic Acids Res. 47, D155-D162.
    Pubmed KoreaMed CrossRef
  23. Lander E.S., Linton L.M., Birren B., Nusbaum C., Zody M.C., Baldwin J., Devon K., Dewar K., Doyle M., and FitzHugh W., et al. (2001). Initial sequencing and analysis of the human genome. Nature 409, 860-921.
    Pubmed CrossRef
  24. Lee H.E., Jo A., Im J., Cha H.J., Kim W.J., Kim H.H., Kim D.S., Kim W., Yang T.J., and Kim H.S. (2019). Characterization of the long terminal repeat of the endogenous retrovirus-derived microRNAs in the olive flounder. Sci. Rep. 9, 14007.
    Pubmed KoreaMed CrossRef
  25. Lee I., Ajay S.S., Yook J.I., Kim H.S., Hong S.H., Kim N.H., Dhanasekaran S.M., Chinnaiyan A.M., and Athey B.D. (2009). New class of microRNA targets containing simultaneous 5'-UTR and 3'-UTR interaction sites. Genome Res. 19, 1175-1183.
    Pubmed KoreaMed CrossRef
  26. Li G., Wu X., Qian W., Cai H., Sun X., Zhang W., Tan S., Wu Z., Qian P., and Ding K., et al. (2016). CCAR1 5' UTR as a natural miRancer of miR-1254 overrides tamoxifen resistance. Cell Res. 26, 655-673.
    Pubmed KoreaMed CrossRef
  27. Liu G., Zhang R., Xu J., Wu C.I., and Lu X. (2015). Functional conservation of both CDS- and 3'-UTR-located microRNA binding sites between species. Mol. Biol. Evol. 32, 623-628.
    Pubmed CrossRef
  28. Marques A.C., Tan J., Lee S., Kong L., Heger A., and Ponting C.P. (2012). Evidence for conserved post-transcriptional roles of unitary pseudogenes and for frequent bifunctionality of mRNAs. Genome Biol. 13, R102.
    Pubmed KoreaMed CrossRef
  29. Nakamura Y., Leppert M., O'Connell P., Wolff R., Holm T., Culver M., Martin C., Fujimoto E., Hoff M., and Kumlin E., et al. (1987). Variable number of tandem repeat (VNTR) markers for human gene mapping. Science 235, 1616-1622.
    Pubmed CrossRef
  30. O'ConnellBrien J., Hayder H., Zayed Y., and Peng C. (2018). Overview of microRNA biogenesis, mechanisms of actions, and circulation. Front. Endocrinol. (Lausanne) 9, 402.
    Pubmed KoreaMed CrossRef
  31. Pacheco A., Berger R., Freedman R., and Law A.J. (2019). A VNTR regulates miR-137 expression through novel alternative splicing and contributes to risk for schizophrenia. Sci. Rep. 9, 11793.
    Pubmed KoreaMed CrossRef
  32. Petri R., Brattas P.L., Sharma Y., Jonsson M.E., Pircs K., Bengzon J., and Jakobsson J. (2019). LINE-2 transposable elements are a source of functional human microRNAs and target sites. PLoS Genet. 15, e1008036.
    Pubmed KoreaMed CrossRef
  33. Piriyapongsa J. and Jordan I.K. (2007). A family of human microRNA genes from miniature inverted-repeat transposable elements. PLoS One 2, e203.
    Pubmed KoreaMed CrossRef
  34. Piriyapongsa J., Marino-Ramirez L., and Jordan I.K. (2007). Origin and evolution of human microRNAs from transposable elements. Genetics 176, 1323-1337.
    Pubmed KoreaMed CrossRef
  35. Qin S., Jin P., Zhou X., Chen L., and Ma F. (2015). The role of transposable elements in the origin and evolution of microRNAs in human. PLoS One 10, e0131365.
    Pubmed KoreaMed CrossRef
  36. Rehmsmeier M., Steffen P., Hochsmann M., and Giegerich R. (2004). Fast and effective prediction of microRNA/target duplexes. RNA 10, 1507-1517.
    Pubmed KoreaMed CrossRef
  37. Roberts J.T., Cardin S.E., and Borchert G.M. (2014). Burgeoning evidence indicates that microRNAs were initially formed from transposable element sequences. Mob. Genet. Elements 4, e29255.
    Pubmed KoreaMed CrossRef
  38. Sabino F.C., Ribeiro A.O., Tufik S., Torres L.B., Oliveira J.A., Mello L.E., Cavalcante J.S., and Pedrazzoli M. (2014). Evolutionary history of the PER3 variable number of tandem repeats (VNTR): idiosyncratic aspect of primate molecular circadian clock. PLoS One 9, e107198.
    Pubmed KoreaMed CrossRef
  39. Salem A.M., Ismail S., Zarouk W.A., Abdul Baky O., Sayed A.A., Abd El-Hamid S., and Salem S. (2013). Genetic variants of neurotransmitter-related genes and miRNAs in Egyptian autistic patients. ScientificWorldJournal 2013, 670621.
    Pubmed KoreaMed CrossRef
  40. Schmitz L.J.M., Klaassen R.V., Ruiperez-Alonso M., Zamri A.E., Stroeder J., Rao-Ruiz P., Lodder J.C., van der Loo R.J., Mansvelder H.D., and Smit A.B., et al. (2017). The AMPA receptor-associated protein Shisa7 regulates hippocampal synaptic function and contextual memory. Elife 6, e24192.
    Pubmed KoreaMed CrossRef
  41. Shi F., Zhang Y., Wang J., Su J., Liu Z., and Wang T. (2019). RNA-sequencing identified miR-3681 as a negative regulator in the proliferation and migration of cervical cancer cells via the posttranscriptional suppression of HGFR. RSC Adv. 9, 22376-22383.
  42. Thompson P.J., Macfarlan T.S., and Lorincz M.C. (2016). Long terminal repeats: from parasitic elements to building blocks of the transcriptional regulatory repertoire. Mol. Cell 62, 766-776.
    Pubmed KoreaMed CrossRef
  43. Vaira V., Roncoroni L., Barisani D., Gaudioso G., Bosari S., Bulfamante G., Doneda L., Conte D., Tomba C., and Bardella M.T., et al. (2014). microRNA profiles in coeliac patients distinguish different clinical phenotypes and are modulated by gliadin peptides in primary duodenal fibroblasts. Clin. Sci. (Lond). 126, 417-423.
    Pubmed CrossRef
  44. Vaz C., Ahmad H.M., Sharma P., Gupta R., Kumar L., Kulshreshtha R., and Bhattacharya A. (2010). Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood. BMC Genomics 11, 288.
    Pubmed KoreaMed CrossRef
  45. Wicker T., Sabot F., Hua-Van A., Bennetzen J.L., Capy P., Chalhoub B., Flavell A., Leroy P., Morgante M., and Panaud O., et al. (2007). A unified classification system for eukaryotic transposable elements. Nat. Rev. Genet. 8, 973-982.
    Pubmed CrossRef
  46. Wingender E., Chen X., Fricke E., Geffers R., Hehl R., Liebich I., Krull M., Matys V., Michael H., and Ohnhauser R., et al. (2001). The TRANSFAC system on gene expression regulation. Nucleic Acids Res. 29, 281-283.
    Pubmed KoreaMed CrossRef
  47. Yamamura S., Imai-Sumida M., Tanaka Y., and Dahiya R. (2018). Interaction and cross-talk between non-coding RNAs. Cell. Mol. Life Sci. 75, 467-484.
    Pubmed KoreaMed CrossRef


Research Article

Mol. Cells 2020; 43(7): 607-618

Published online July 31, 2020

Copyright © The Korean Society for Molecular and Cellular Biology.

Enhancer Function of MicroRNA-3681 Derived from Long Terminal Repeats Represses the Activity of Variable Number Tandem Repeats in the 3’ UTR of SHISA7

Hee-Eun Lee1,2,3 , Sang-Je Park3 , Jae-Won Huh3,4 , Hiroo Imai5 , and Heui-Soo Kim2,6, *

1Department of Integrated Biological Science, Pusan National University, Busan 46241, Korea, 2Institute of Systems Biology, Pusan National University, Busan 46241, Korea, 3National Primate Research Center, Korea Research Institute of Bioscience and Biotechnology, Cheongju 28116, Korea, 4Department of Functional Genomics, Korea Research Institute of Bioscience and Biotechnology (KRIBB) School of Bioscience, Korea University of Science and Technology (UST), Daejeon 34113, Korea, 5Department of Cellular and Molecular Biology, Primate Research Institute, Kyoto University, Inuyama 484-8506, Japan, 6Department of Biological Sciences, College of Natural Sciences, Pusan National University, Busan 46241, Korea


Received: March 4, 2020; Revised: May 12, 2020; Accepted: May 27, 2020


microRNAs (miRNAs) are non-coding RNA molecules involved in the regulation of gene expression. miRNAs inhibit gene expression by binding to the 3′ untranslated region (UTR) of their target gene. miRNAs can originate from transposable elements (TEs), which comprise approximately half of the eukaryotic genome and one type of TE, called the long terminal repeat (LTR) is found in class of retrotransposons. Amongst the miRNAs derived from LTR, hsa-miR-3681 was chosen and analyzed using bioinformatics tools and experimental analysis. Studies on hsa-miR-3681 have been scarce and this study provides the relative expression analysis of hsa-miR-3681-5p from humans, chimpanzees, crab-eating monkeys, and mice. Luciferase assay for hsa-miR-3681-5p and its target gene SHISA7 supports our hypothesis that the number of miRNA binding sites affects target gene expression. Especially, the variable number tandem repeat (VNTR) and hsa-miR-3681-5p share the binding sites in the 3’ UTR of SHISA7, which leads the enhancer function of hsa-miR-3681-5p to inhibit the activity of VNTR. In conclusion, hsa-miR-3681-5p acts as a super-enhancer and the enhancer function of hsa-miR-3681-5p acts as a repressor of VNTR activity in the 3′ UTR of SHISA7.

Keywords: long terminal repeat, miR-3681-5p, SHISA7, transposable elements, variable number tandem repeat


Transposable elements (TEs) comprise approximately half of the eukaryotic genome and are known to insert into the genome as stable genomic components (Bourque et al., 2018; Wicker et al., 2007). TEs are divided into two classes—retrotransposons (class I) and DNA transposons (class II). Retrotransposons use the ‘copy and paste’ mechanism. The retrotransposons are first transcribed into an RNA intermediate, which is reverse transcribed into a DNA intermediate (Agren and Clark, 2018; Bourque et al., 2018; Lander et al., 2001; Wicker et al., 2007). Long terminal repeat (LTR) is a member of the retrotransposon family and the composition of LTR in humans is approximately 9%. An LTR consists of innate enhancer activity, however, transcription factor (TF), nucleotide substitutions, transcription start sites, and epigenetics may provide alternative enhancer activity of LTR elements (Thompson et al., 2016). LTRs recruit TF and enhance the transcription of host genes (Gonzalez-Cao et al., 2016; Hu et al., 2017). TEs can generate regulators of genes, such as microRNAs (miRNAs), TFs, and variable number tandem repeats (VNTRs) (Feschotte, 2008; Lee et al., 2019; Piriyapongsa et al., 2007; Qin et al., 2015; Roberts et al., 2014; Sabino et al., 2014).

miRNAs are small non-coding RNA molecules, approximately 19 to 24 nucleotides long, which are essential for gene regulation (Ambros et al., 2003; Bartel, 2004; Kim, 2005; O'Brien et al., 2018). miRNAs have a unique seed region, approximately six nucleotides long, that binds to the 3′ untranslated region (UTR) of the target mRNA. In most of cases, miRNAs regulate gene expression by inhibiting gene expression; however, recent study has reported the presence of enhancer miRNAs (Lee et al., 2019). In addition, some miRNAs bind to the 5′ UTR of the target transcripts and to coding sequences, to regulate target gene expression (Brummer and Hausser, 2014; Gu et al., 2014; Hausser et al., 2013; Lee et al., 2009; Li et al., 2016; Liu et al., 2015). In studies on miRNA, the number of miRNA binding sites in the target gene was not an important consideration in selecting the best target genes. Previous studies have suggested that miRNAs derived from transposable element (MDTE) and MDTEs share sequences (Lee et al., 2019; Petri et al., 2019; Piriyapongsa and Jordan, 2007; Piriyapongsa et al., 2007; Qin et al., 2015; Roberts et al., 2014). Hsa-miR-3681 is derived from an LTR element and has not been studied much. A few studies on hsa-miR-3681 have reported on its dysregulation in human disease and cancer and downregulation in cervical cancer (Shi et al., 2019; Vaira et al., 2014; Vaz et al., 2010).

One of target genes for hsa-miR-3681-5p, SHISA7, is a regulator of long-term synaptic potentiation, and plays an important role in regulating the neurotransmitter of gamma‐aminobutyric acid (Han et al., 2019). A few reports have predicted that SHISA7 is an miRNAs target and one study has reported that miRNA downregulates SHISA7 expression in neuroblastoma cells (Cai et al., 2018; Marques et al., 2012; Yamamura et al., 2018). The 3′ UTR of SHISA7 includes VNTRs, which are organized into 10 to 100 bp tandem repeats and often shows variations in the number of repeats among individuals (Nakamura et al., 1987). Previous reports have suggested that the VNTR in the 3′ UTR of the human dopamine transporter (DAT) regulates the expression of DAT (Inoue-Murayama et al., 2002). Another study has shown that the 3′ UTR can act as a regulator and enhancer to induce transcription (Jash et al., 2012).

In this study, the relative expression of the MDTEs, hsa-miR-3681-5p and its target SHISA7, was profiled in human, chimpanzee, crab-eating monkey, and mouse to compare its relative expression in evolutionary terms. Another aim of this study was to evaluate the impact of the number of miRNA binding sites on the regulation of target gene expression. In addition, the role of VNTR, with conserved hsa-miR-3681-5p seed region, in the 3′ UTR of SHISA7 is discussed for further studies.


Ethical statement

Experiments with the Western chimpanzee were carried out in accordance with the guidelines and regu­lations approved by the Animal Experimentation Committees of Kyoto University (2018-004). Experiments with Crab-eating monkey were carried out in accordance with guidelines and regulation approved by Korea Research Institute of Bioscience & Biotechnology (KRIBB-AEC-15046).

Bioinformatic analyses

The sequence of hsa-miR-3681-5p was downloaded from miRbase v22.1 ( (Kozomara et al., 2019), and then the sequence was used to localized in human genome (GRCh38) and to download sequence of LTR16D1 by UCSC Genome Browser ( (Agarwal et al., 2015). The sequences of hsa-miR-3681-5p and LTR16D1 were aligned using BioEdit ( (Hall, 1999) to compare the analogy. TargetScanHuman ( (Agarwal et al., 2015) was used to list out the target gene candidates of hsa-miR-3681-5p (Table 1).

The structural interaction between hsa-miR-3681-5p and the 3′ UTR of SHISA7 was generated using BiBiServ RNAhybrid ( (Rehmsmeier et al., 2004). BiBiServ RNAhybrid is used to predict target genes and analyze the minimum free energy values, which represent the score of binding affinity between the miRNA and the target gene. The sequences of SHISA7 and hsa-miR-3681-5p were used to detect complementary binding sites of hsa-miR-3681-5p in the 3′ UTR of SHISA7. Primers were designed using Primer3 v 4.1 ( (Koressaar et al., 2018) (Table 2).

The putative TF binding sites near the 9.5 VNTRs of the 3′ UTR of SHISA7 was predicted using MATCH in TRANSFAC v8.0 ( (Kel et al., 2003; Wingender et al., 2001). Threshold values greater than 0.98 in both core match and matrix match were used for the prediction. Matrix match indicates the quality of the match between a matrix and a random part of the input sequence. Core match determines the quality of a match between the core sequences of a matrix.

Human and animal samples

Total RNAs from 13 human tissues (brain, heart, lung, liver, kidney, spleen, stomach, small intestine, colon, muscle, testis, prostate, and uterus) and 10 mouse tissues (brain, heart, lung, liver, kidney, spleen, stomach, smooth muscle, testis, and spinal cord) were purchased from Clontech (USA).

A total of 14 female crab-eating monkey tissue samples (cerebellum, cerebrum, heart, lung, liver, kidney, spleen, stomach, small intestine, large intestine, uterus, pancreas, bladder, and spinal cord) were provided by the National Primate Research Center (Korea). Total RNA was extracted from 14 tissue samples of the female crab-eating monkey by using Hybrid-RTM (GeneAll, Korea), according to the manufacturer’s instructions.

Tissue samples from the female Western chimpanzee were provided from the Kumamoto sanctuary, Kyoto University, to Primate Research Institute in Inuyama, Japan, via GAIN and the male Western chimpanzee samples were provided by the Primate Research Institute. All experiments using samples from the Western chimpanzee were done at the Primate Research Institute. Total RNA was extracted from 11 tissues of healthy male Western chimpanzees (cerebellum, heart, lung, liver, kidney, spleen, stomach, small intestine, colon, muscle, and testis) and female Western chimpanzees (cerebellum, heart, lung, liver, kidney, spleen, stomach, small intestine, colon, muscle, and ovary) by using Hybrid-RTM, according to the manufacturer’s instructions.

The RNA samples were quantitated using the ND-1000 UV-Vis spectrophotometer (NanoDrop, USA). A total of 500 ng of quantified RNA was reverse transcribed from mRNA by using PrimeScript RT Reagent Kit with gDNA Eraser (TaKaRa, Japan) and from miRNA by using HB miR Multi Assay KitTM system Ⅰ (HeimBiotek, Korea).

Quantitative polymerase chain reaction amplification

The quantitative polymerase chain reaction (qPCR) primer information for SHISA7 and the reference gene is listed in Table 2. cDNA samples from humans, male and female Western chimpanzees, female crab-eating monkeys, and male mice were used with the SYBR Green Q-PCR Master Mix with High Rox (SmartGene, Korea) for qPCR, according to the manufacturer’s instructions in a Rotor-Gene Q system (Qiagen, Germany), under the following qPCR conditions; initialization step at 95°C for 2 min, followed by 45 thermal cycles of 95°C for 5 s, 55°C for 10 s, and 72°C for 15 s; standard melting conditions of the ramp ranged from 55°C to 99°C, with a 1°C rise at each step. Glyceraldehyde 3-phosphate dehydrogenase (G3PDH) was used as the reference gene for the normalization of relative expression analysis for SHISA7. All samples were amplified in triplicates, and the relative expression data was analyzed according to the 2-ΔC t method, where ΔCt = Ct (SHISA7) – Ct (G3PDH). All the bar in the graphs were plotted as the mean ± SD.

The miRNA level cDNA samples in human, male and female Western chimpanzee, female crab-eating monkey, and male mouse were used with the HB_I Real-Time PCR Master mix kit (HeimBiotek) to perform qPCR, according to the manufacturer’s protocol in a Rotor-Gene Q system, under the following qPCR conditions; initialization step at 95°C for 2 min, followed by 45 thermal cycles of 95°C for 5 s, 55°C for 10 s, and 72°C for 15 s; standard melting conditions of the ramp ranged from 55°C to 99°C, with a 1°C rise at each step. Small nuclear RNA (snRNA) U6 was used as the reference gene for normalization of relative expression analysis for miR-3681-5p (5′-UAGUGGAUGAUGCACUCUGUGC-3′). All samples were amplified in triplicates, and the relative expression data was analyzed according to the 2-ΔC t method, where ΔCt = Ct(hsa-miR-3681-5p) – Ct(U6). All the bar in the graphs were plotted as the mean ± SD.

Genomic DNA extraction and gene cloning

Genomic DNA was extracted from a human cell line HEK293A using DNeasy Blood & Tissue Kit (Qiagen), according to the manufacturer’s protocol. Genomic DNA was then used for PCR amplification using the primer list shown in Table 2. The 20 µl PCR mix contained 10 µl of 2× TOPsimple DyeMix (aliquot)-HOT premix (Enzynomics, Korea), 7 µl of distilled water, 1 µl of gDNA template, and 1 µl of forward and reverse primers (10 pmole/µl) each. PCR conditions were as follows: initialization step at 95°C for 5 min, followed by 35 thermal cycles of 94°C for 40 s, annealing temperatures listed in Table 2 for 40 s, 72°C 40 s, and the final elongation step at 72°C 5 min. The PCR products were separated on a 1.5% agarose gel, and purified with ExpinTM Gel SV (GeneAll), according to the manufacturer’s protocol. The purified PCR products were cloned into a psi-CHECK2 vector (Promega, USA) using the LigaFastTM Rapid DNA Ligation System (Promega), as per the manufacturer’s protocol. The cloned plasmid DNA was isolated by using ExprepTM Plasmid SV, mini (GeneAll).

Cell culture and luciferase assay

The lung cancer derived cell line A549 was grown at 37°C in a 5% (v/v) CO2 incubator at Rosewell Park Memorial Institute (RPMI) (Gibco, USA), supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS) (Gibco), and 1% (v/v) antibiotic-antimycotic (Gibco). The cells were plated in 24-well plates at a cell-density of 1 × 105 cells/well and grown to 80% confluence. After 24 h of incubation at 37°C in a 5% (v/v) CO2 incubator, the cells were transfected with psi-CHECK2 vector cloned with different SHISA7 regions and miRNA mimics. A total of 500 ng of plasmid vector and 100 µM of mimics were used during cell transfection. Co-transfection was done using jetPRIME® (Polyplus, France), under the manufacturer’s instructions. After 24 h of incubation at 37°C in a 5% (v/v) CO2 incubator, the cells were lysed using 1× passive buffer (Promega), as per the manufacturer’s protocol, followed by incubation in –80°C deep freezer for over 3 h. Firefly and Renilla luciferase activities were assessed using the Dual-Luciferase® Reporter Assay System (Promega), according to the manufacturer’s instructions. Lane 1 was transfected with only the plasmid vector of each SHISA7 region, lane 2 was co-transfected with plasmid vector containing miRNA negative control (Bioneer, Korea), lane 3 was co-transfected with plasmid vector containing miR-3681 mimic (Bioneer), lane 4 was co-transfected with plasmid vector containing miR-3681-5p inhibitor mimic (Bioneer), and lane 5 was co-transfected with plasmid vector containing both miR-3681 mimic and miR-3681-5p inhibitor mimic. The negative control mimic is made up of scrambled miRNAs; miR-3681 mimic is a chemically synthesized double-stranded RNA oligonucleotide and miR-3681-5p inhibitor is a single-stranded synthetic inhibitor with target miRNA complementary binding sequence. Each experiment was performed in triplicates and data is presented with bars as the mean ± SD. The Student’s t-test in Excel 2016 (Microsoft, USA) was used to determine the significance of the results (*P < 0.08, **P < 0.06, ***P < 0.04).


Long terminal repeats derived microRNA-3681

The sequence of hsa-miR-3681-5p (5′-UAGUGGAUGAUGCACUCUGUGC-3′) was downloaded from miRbase v22.1 and used for blast search using the UCSC genome browser (GRCh38), to confirm the location and the nearest gene in human chromosomes. The seed region of hsa-miR-3681-5p is 5′-AGUGGAU-3′ and hsa-miR-3681 is present in the p arm of human chromosome 2. Moreover, hsa-miR-3681 overlaps with LTR16D1. The sequence of LTR16D1 was downloaded from the UCSC genome browser to determine the analogy between target miRNA and its derived gene (Fig. 1). The alignment result shows that hsa-miR-3681-5p is derived from LTR16D1, as seen from the perfectly matched sequence.

Bioinformatic analyses of hsa-miR-3681-5p and SHISA7

The target gene list of hsa-miR-3681-5p was downloaded from Target Scan Human and the candidates were selected based on the highest number of total seed sites that are complementary to the 3′ UTR of the target gene (Table 1). Out of 2,424 target genes, 13 were selected from the list and SHISA7 showed the highest number of total seed sites and 8-mer hsa-miR-3681-5p binding sites in the 3′ UTR.

The schematic structure of SHISA7 shows that it is inserted inversely in chromosome 19 of humans and that there are three CpG islands that cover the 5′ UTR, exon 2, and 3′ UTR, respectively (Fig. 2A). The CpG island on both UTRs are fully covered; however, the one on exon 2 is partially covered. The 3′ UTR of SHISA7 contains a six 9-mer and two 8-mer hsa-miR-3681-5p complementary binding site (Supplementary Fig. S1). Using BiBiServ RNAhybrid, the structural interaction between hsa-miR-3681-5p and 3′ UTR of SHISA7 was observed (Fig. 2B). The minimum free energy value between hsa-miR-3681-5p and SHISA7 is –26.4 kcal/mol. The seed region of hsa-miR-3681-5p is well conserved when RNA hybrid with the 3′ UTR of SHISA7.

Three primers were designed from the 3′ UTR of SHISA7 to examine if difference in expression is related to the number of 9-mer hsa-miR-3681-5p (Table 2). Primer #1, #2, and #3 have one, three, and six, 9-mer binding sites of hsa-miR-3681-5p in the 3′ UTR of SHISA7, respectively.

Relative expression analyses of hsa-miR-3681-5p and SHISA7 in human, male and female Western chimpanzee, female crab-eating monkey, and male mouse tissues

Relative expression analyses of hsa-miR-3681-5p and SHISA7 was done by qPCR and re-analyzed using Heatmapper. The heatmap of relative expression of hsa-miR-3681-5p showed ubiquitous expression in human tissues; however, the values were under 0.004 (Fig. 3A). The muscles showed the highest, whereas the spleen and the lung the lowest, in humans. The male and female Western chimpanzees also showed low relative expression values of hsa-miR-3681-5p. For the male and female Western chimpanzees, the expression in the kidney and the small intestine was the highest (Figs. 3B and 3C), respectively. Interestingly, the female crab-eating monkeys showed high relative expression in the spinal cord with a value of over 0.12, whereas other tissues showed expression values lower than 0.02 (Fig. 3D). The heatmap of relative expression of hsa-miR-3681-5p in the male mice showed highest expression in the liver and the kidney; however, the value was between 0.0004 and 0.0005 (Fig. 3E). Lowest expression of hsa-miR-3681-5p was seen in the spleen of mice. A 9-mer hsa-miR-3681-5p binding site, in the 3′ UTR of SHISA7, showed expression in the stomach and the small intestine of humans; however, other tissues did not (Fig. 3A). The same 9-mer binding primer is relatively high in the testis, stomach, and cerebellum of the male Western chimpanzees (Fig. 3B), cerebellum of the female Western chimpanzees (Fig. 3C), and the bladder of the crab-eating monkeys (Fig. 3D). The male mice showed a higher expression value than hsa-miR-3681-5p, with the highest value of approximately 0.015 in the spleen and the lowest, approximately 0.002, in the kidney and the brain; both results being opposite, compared to hsa-miR-3681-5p (Fig. 3E). The three 9-mer hsa-miR-3681-5p binding site in the 3′ UTR of SHISA7 showed highest relative expression in the brain of humans (Fig. 3A), the stomach and testis of the male Western chimpanzees (Fig. 3B), the cerebellum of the female Western chimpanzees (Fig. 3C), the bladder of the female crab-eating monkeys (Fig. 3D), and the spleen of the male mice (Fig. 3E). The three 9-mer binding sites in the 3′ UTR of SHISA7 showed similar results to one 9-mer binding site in SHISA7; however, the expression value was greater in all samples.

Except for humans, the relative expression results for the female and male Western chimpanzees, crab-eating monkeys, and mice showed similar patterns for 9-mer hsa-miR-3681-5p binding sites. The male Western chimpanzees had the highest relative expression in the testis and the stomach for both one 9-mer hsa-miR-3681-5p binding primers (Fig. 3B). The female Western chimpanzees had the highest relative expression in the cerebellum for both 9-mer hsa-miR-3681-5p binding primers (Fig. 3C). The female crab-eating monkeys had the highest relative expression in the bladder for both primers (Fig. 3D). The male mice had the highest relative expression in the spleen and the lowest relative expression in the kidney and the brain, for both primers (Fig. 3E). The relative expression data in graph of all hsa-miR-3681-5p and primers are shown in Supplementary Figs. S2-S6.

The luciferase analysis of hsa-miR-3681-5p and SHISA7

To analyze the correlation between the 3′ UTR of SHISA7 and the number of 9-mer hsa-miR-3681-5p binding sites, the lung cancer derived cell line, A549, was used for co-transfection (Fig. 4). The result of one 9-mer for hsa-miR-3681-5p did not show any significant outcome. The result showed that, compared to control and the negative control, three and six 9-mer hsa-miR-3681-5p binding primers showed enhancer activity when hsa-miR-3681 mimic treatment was done. In contrast, the activity decreased when hsa-miR-3681-5p inhibitor was used. Interestingly, when the hsa-miR-3681 mimic and hsa-miR-3681-5p inhibitor are used together, the activity of three and six 9-mer hsa-miR-3681-5p binding plasmid enhanced approximately one and a half to two-fold more than when hsa-miR-3681 mimic was used alone.

The prediction of transcription factors in 3′ UTR of SHISA7

The 3′ UTR of SHISA7 sequence was examined using TRANSFAC v8.0 with the assumption that the enhancer activity of SHISA7, with three and six 9-mer hsa-miR-3681, was in co-operation with TF. A total of 44 TF binding sites, with thresholds of over 1 for core match and over 0.98 for matrix match, were found in the 3′ UTR of SHISA7.

The prediction and impact of VNTRs in the 3′ UTR of SHISA7

The sequence and name of the TFs near hsa-miR-3681-5p 9-mer seed regions are indicated within the box in Fig. 5. The prediction of TF provided the possibility of VNTR in the 3′ UTR of SHISA7.

The schematic structure of SHISA7 and its sequence shows a detailed understanding of VNTRs in the 3′ UTR (Fig. 6A). The predicted VNTRs were aligned using BioEdit to determine the sequences (Fig. 6B). Interestingly, nine complete and one half of VNTR sequences were obtained near the 9-mer hsa-miR-3681-5p binding sites in the 3′ UTR of SHISA7. Six 9-mer hsa-miR-3681-5p binding sites were well conserved in VNTRs and except for a few unpaired sequences; approximately 70 to 75 sequences were present in the full VNTRs and approximately 25 to 30 nucleotides in the half VNTR.


This study focused on the idea that the number of miRNA binding sites in the 3′ UTR of a target gene will affect its expression. For evolutionary profiling, examination of the relative expression analysis on MDTE hsa-miR-3681-5p was performed by qPCR in the target gene of hsa-miR-3681-5p SHISA7, in human, chimpanzee, crab-eating monkey, and mouse. This analysis provided an understanding on how MDTE hsa-miR-3681-5p acted as an enhancer and blocked the activity of the VNTR.

SHISA7 is a well-known brain and neurotransmitter related gene; however, actual molecular biological studies on SHISA7 are scarce (Cai et al., 2018; Han et al., 2019; Schmitz et al., 2017). Moreover, there is lack of studies on hsa-miR-3681-5p. Therefore, collecting data on hsa-miR-3681-5p and SHISA7 has proven to be difficult. In our analysis, the heatmap showed that the relative expression value of hsa-miR-3681-5p was highest in the spinal cord of the crab-eating monkey and the value of hsa-miR-3681-5p was low in humans, chimpanzees, and mice (Fig. 3). The relative expression results with one and three 9-mer hsa-miR-3681-5p binding sites in the 3′ UTR of SHISA7 showed an interesting pattern in chimpanzees, monkeys, and mice. The result from male and female chimpanzees, monkeys, and mice showed approximately two-fold higher expression value in the three 9-mer hsa-miR-3681-5p binding region than one 9-mer hsa-miR-3681-5p. The relative expression in humans did not show any distinguishing patterns; however, the expression of three 9-mer hsa-miR-3681-5p binding region in SHISA7 increased greatly compared with one 9-mer hsa-miR-3681-5p binding primer. SHISA7 is known as a brain related gene and human data shows that binding number of 9-mer hsa-miR-3681-5p is essential for relative expression. The product size of both primers was approximately 160 bp and the size of the primers did not affect the value of relative expression. Previously, SHISA7 was shown to be a regulator of neurotransmitters and the species-based comparison of relative expression shows that humans and male and female chimpanzees have a similar pattern in the brain samples. The relative expression value was low in hsa-miR-3681-5p; however, the expression value for three hsa-miR-3681-5p binding region the in 3′ UTR of SHISA7 was higher.

We hypothesized that the number of 9-mer hsa-miR-3681-5p binding sites affects the relative expression data and the luciferase assay. Previously, a miRNA study reported that miR-185 downregulates the expression of SHISA7 in human and mouse neuroblastoma cells (Marques et al., 2012). In the case of hsa-miR-3681-5p, the plasmid with one of 9-mer hsa-miR-3681-5p binding site did not show any significant result; however, the plasmid with three and six 9-mer hsa-miR-3681-5p binding sites showed similar patterns. Instead of downregulating the SHISA7, the plasmid with three and six 9-mer hsa-miR-3681-5p binding regions up regulated the expression of SHISA7, in the presence of the hsa-miR-3681 mimic. In the presence of the hsa-miR-3681-5p inhibitor, the expression decreased more than the control. Interestingly, when both mimic and inhibitor were, the activity was upregulated, compared to the mimic treatment alone. The prediction was that since miRNA mimic is composed of double-stranded RNA oligonucleotides of the target miRNA, hsa-miR-3681-3p must be affecting SHISA7, however, complementary binding sites for hsa-miR-3681-3p are not present in the 3′ UTR of SHISA7. To discover the enhancer activity in both the miRNA mimic and the inhibitor treated lane, the sequence of 3′ UTR SHISA7 was analyzed and various TFs and VNTRs were seen to be included in the 3′ UTR of SHISA7. A total of nine and a half VNTRs existed and TFs in VNTR were present with their own patterns. TF MEIS1 was predicted near the seed region of five hsa-miR-3681-5p binding site and three TF GATA-1 was predicted near the 1st, 8th, and 9th VNTR start sites. The threshold of both core match and matrix match was set to 0.95 to check if there are missing GATA-1; however, TF prediction did not include more GATA-1. However, OF-miRNA-307 study provided the possibility that the TF near the binding site of miRNA in the 3′ UTR of the target gene might have a chance to cooperate with miRNA to gain enhancer activity (Lee et al., 2019).

Another diagnosis of enhancer activity shown in both hsa-miR-3681 mimic and hsa-miR-3681-5p inhibitor is VNTRs. VNTR and miRNA studies are scarce; however, a few studies have been done on brain disease related genes. A study analyzed autism and neurotransmitter related genes and miRNAs; MAOA, MAOB, DRD2, miRNA-431, and -21 for genomic sequence variations (Salem et al., 2013). Another study revealed that VNTRs regulate miRNA-137 by alternative splicing and this event increases the risk of schizophrenia (Pacheco et al., 2019). The deletion form of miRNA-137 transcripts is more frequent when an increased number of VNTRs were detected. Similar to our report, one of the reports used the luciferase assay to check VNTR and miRNA-491 expression (Jia et al., 2016). The result shows that when miRNA-491 mimic treatment was done with different number of VNTR copies, the expression was downregulated when more copies of VNTRs were included. In contrast, the expression was upregulated when anti-miRNA-491 was treated to different quantities of VNTR copies. In our report, the both hsa-miR-3681 mimic and hsa-miR-3681-5p inhibitor treatment result shows upregulation in all luciferase assays. The promoter activity is different within the length of VNTRs in the LTR12C element and it affects the expression of RAE1 by cooperating with TF, NF-Y (Jung et al., 2017). The hypothesis was that miRNA affects VNTR by repressing the activity; in rare cases VNTRs gain enhancer activity by blocking hsa-miR-3681 mimics by hsa-miR-3681-5p inhibitor. In other words, we assume that VNTRs help hsa-miR-3681-5p to gain enhancer activity; however, the activity of VNTR might be repressed more than it should be by hsa-miR-3681-5p.

The illustration of the summary of this study can be seen in Fig. 7. miRNA derived from LTR or any of the TEs, called MDTEs, binds to the 3′ UTR of the target gene. In some cases, the 3′ UTR of target gene contains VNTRs such as SHISA7 gene and this study provides the possibility that MDTE may enhances the gene expression, but its enhancer activity may represses the activity of VNTR. The MDTE recruits alternative enhancer and promoter, activators, mediators, TFs, and RNA Pol II to function as an enhancer. The relative expression data confirmed that the number of miRNA binding sites is important for miRNA activity in the 3′ UTR of the target gene. Another evidence that miRNAs or MDTEs can function as enhancers is their ability to repress the activity of VNTRs. Further studies are needed to confirm that the enhancer activity of both hsa-miR-3681 mimic and hsa-miR-3681-5p inhibitor is contributed by VNTRs or TFs.


This research was supported by the Cooperative Research Program of Primate Research Institute, Kyoto University (2019-B-7) and the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2018R1D1A1B07049460). We thank Kumamoto sanctuary and Primate Research Institute in Inuyama, Japan for providing the samples of Western chimpanzee male and female samples.


H.E.L. designed and performed all the experiments including writing the manuscript, J.W.H. and S.J.P. provided the crab-eating monkey samples, H.I. provided the Western chimpanzee samples, and H.S.K. commented and revised the manuscript.


The authors have no potential conflicts of interest to disclose.

Fig 1.

Figure 1.The alignment result of LTR-LTR16D1 and hsa-miR-3681-5p. The black box shows the conserved region of hsa-miR-3681-5p and LTR16D1. The sequence of hsa-miR-3681-5p is shown under the alignment and the seed region is in bold.
Molecules and Cells 2020; 43: 607-618

Fig 2.

Figure 2.Bioinformatics analysis of hsa-miR-3681-5p and its target gene SHISA7. (A) Schematic structure of SHISA7 and the alignment result. The coding sequences are in black and the untranslated regions (UTRs) are in dark grey. Three CpG islands are present in SHISA7, and one each of the CpG island is covering the 5′ UTR, exon 2, and the 3′ UTR. CpG islands are shown in light grey. In the 3′ UTR of SHISA7, a total of six 9-mer binding sites of hsa-miR-3681-5p exist and from the sequence nine seeds of hsa-miR-3681-5p is shown in the black box. (B) RNA hybrid of hsa-miR-3681-5p and SHISA7. The seed region of hsa-miR-3681-5p and complementary binding site in the 3′ UTR of SHISA7 is shown in the grey box. The minimum free energy value between hsa-miR-3681-5p and 3′ UTR of SHISA7 is –26.4 kcal/mol. The light green represents hsa-miR-3681-5p and red represents the 3’ UTR of SHISA7.
Molecules and Cells 2020; 43: 607-618

Fig 3.

Figure 3.Relative expression analyses of hsa-miR-3681-5p and SHISA7 by heatmapper. (A) Heatmap of relative expression of hsa-miR-3681-5p and two primers of SHISA7 in humans. (B) Heatmap of relative expression on hsa-miR-3681-5p and two primers of SHISA7 in male Western chimpanzee. (C) Heatmap of relative expression on hsa-miR-3681-5p and two primers of SHISA7 in female Western chimpanzee. (D) Heatmap of relative expression on hsa-miR-3681-5p and two primers of SHISA7 in female crab-eating monkey. Crab-eating monkey is shortened as CEM. (E) Heatmap of relative expression on hsa-miR-3681-5p and two primers of SHISA7 in male mouse.
Molecules and Cells 2020; 43: 607-618

Fig 4.

Figure 4.Luciferase analysis of hsa-miR-3681-5p and SHISA7 in A549 cell. The information on each color of the bar is provided at the top of the graph. All the bar in the graphs were plotted as the mean ± SD. The Student’s t-test was used to determine the significance of the results. *P < 0.08, **P < 0.06, ***P < 0.04.
Molecules and Cells 2020; 43: 607-618

Fig 5.

Figure 5.Prediction of TF binding sites and VNTR in the 3′ UTR of SHISA7. Each predicted VNTR is divided with dotted boxes. The predicted TFs are in black boxes with the name of each TF and the 9-mer hsa-miR-3681-5p binding sites are in bold black lines.
Molecules and Cells 2020; 43: 607-618

Fig 6.

Figure 6.Predicted VNTR regions in 3' UTR of SHISA7. (A) The schematic structure of VNTR in the 3′ UTR of SHISA7. The sequence of two white dotted lines, in the schematic structure of the 3′ UTR of SHISA7, is shown under the structure. Red bold lines represent the seed region of hsa-miR-3681-5p, and the dotted boxes in the sequence represent each VNTRs. Nine complete VNTRs and one half of VNTR sequences are seen. (B) The alignment of predicted VNTR in the 3′ UTR of SHISA7. A dot represents the identical nucleotide of the first sequence and a missing nucleotide is marked with a swung dash (~) or a hyphen (-). The grey box represents the conserved seed region of hsa-miR-3681-5p.
Molecules and Cells 2020; 43: 607-618

Fig 7.

Figure 7.Schematic illustration of overall summarization on enhancer activity of VNTR in 3’ UTR of SHISA7 repressed by hsa-miR-3681.
Molecules and Cells 2020; 43: 607-618

. The list of target gene candidates of hsa-miR-3681-5p.

Gene nameAbbreviationCoordinatesTranscript IDTotal sites8mer7mer-m87mer-A16mer
Shisa family member 7SHISA7chr19:55,428,738-55,442,863ENST00000376325.4128223
ADP-ribosylation factor-like 10ARL10chr5:176,365,373-176,381,963ENST00000310389.540222
Solute carrier family 8 (sodium/calcium exchanger), member 2SLC8A2chr19:47,428,017-47,471,893ENST00000236877.670074
Zinc finger and BTB domain containing 37ZBTB37chr1:173,868,082-173,903,547ENST00000367701.540402
K(lysine) acetyltransferase 7KAT7chr17:49,788,681-49,835,026ENST00000259021.440225
Glutamate receptor, ionotropic, N-methyl D-aspartate 2BGRIN2Bchr12:13,537,337-13,980,356ENST00000609686.152125
Lysine (K)-specific demethylase 5AKDM5Achr12:280,057-389,320ENST00000399788.250324
RNA binding motif protein 28RBM28chr7:128,297,685-128,343,908ENST00000223073.241124
Neuronal growth regulator 1NEGR1chr1:71,395,943-72,282,539ENST00000357731.541214
Zinc finger and BTB domain containing 20ZBTB20chr3:114,304,949-115,155,228ENST00000462705.140313
Peroxisomal biogenesis factor 26PEX26chr22:18,077,990-18,105,396ENST00000329627.741300
Peptidylprolyl isomerase (cyclophilin)-like 4PPIL4chr6:149,504,495-149,546,043ENST00000340881.240313

SHISA7, shown in bold, was selected as the hsa-miR-3681-5p target gene. Each column shows the name of the target gene, abbreviation of the gene name, the coordinates in the human chromosome, transcript ID, total hsa-miR-3681-5p binding sites in the 3′ UTR, number of binding sites for 8-mer, number of binding sites for 7-mer-m8, number of binding sites for 7-mer-A1, and number of binding sites for 6-mer..

. The list of primer information on SHISA7 and the reference gene.

PrimerSequencesTemperature (°C)Details
9mer1F: CATCTCCAGGGATCCACTTC55One 9mer hsa-miR-3681-5p in 3’ UTR of SHISA7
9mer3F: AGGATCCACGAGAGCCAAT59Three 9mer hsa-miR-3681-5p in 3’ UTR of SHISA7
9mer6F: CACTACCTCCCAGTATCCA55Six 9mer hsa-miR-3681-5p in 3’ UTR of SHISA7
G3PDHF: GAA ATC CCA TCA CCA TCT TCC AGG55The reference gene; Glyceraldehyde 3-phosphate dehydrogenase (G3PDH)

Each primer was designed based on the quantity of 9mer hsa-miR-3681-5p binding sites. The name of the primer, sequence of each forward (F) and reverse (R) primer, annealing temperature and details about the primer is shown in the table..


  1. Agarwal V., Bell G.W., Nam J.W., and Bartel D.P. (2015). Predicting effective microRNA target sites in mammalian mRNAs. Elife 4, e05005.
    Pubmed KoreaMed CrossRef
  2. Agren J.A. and Clark A.G. (2018). Selfish genetic elements. PLoS Genet. 14, e1007700.
    Pubmed KoreaMed CrossRef
  3. Ambros V., Bartel B., Bartel D.P., Burge C.B., Carrington J.C., Chen X., Dreyfuss G., Eddy S.R., Griffiths-Jones S., and Marshall M., et al. (2003). A uniform system for microRNA annotation. RNA 9, 277-279.
    Pubmed KoreaMed CrossRef
  4. Bartel D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.
    Pubmed CrossRef
  5. Bourque G., Burns K.H., Gehring M., Gorbunova V., Seluanov A., Hammell M., Imbeault M., Izsvak Z., Levin H.L., and Macfarlan T.S., et al. (2018). Ten things you should know about transposable elements. Genome Biol. 19, 199.
    Pubmed KoreaMed CrossRef
  6. Brummer A. and Hausser J. (2014). MicroRNA binding sites in the coding region of mRNAs: extending the repertoire of post-transcriptional gene regulation. Bioessays 36, 617-626.
    Pubmed CrossRef
  7. Cai H., Zhu X.X., Li Z.F., Zhu Y.P., and Lang J.H. (2018). MicroRNA dysregulation and steroid hormone receptor expression in uterine tissues of rats with endometriosis during the implantation window. Chin. Med. J. (Engl). 131, 2193-2204.
    Pubmed KoreaMed CrossRef
  8. Feschotte C. (2008). Transposable elements and the evolution of regulatory networks. Nat. Rev. Genet. 9, 397-405.
    Pubmed KoreaMed CrossRef
  9. Gonzalez-Cao M., Iduma P., Karachaliou N., Santarpia M., Blanco J., and Rosell R. (2016). Human endogenous retroviruses and cancer. Cancer Biol. Med. 13, 483-488.
    Pubmed KoreaMed CrossRef
  10. Gu W., Xu Y., Xie X., Wang T., Ko J.H., and Zhou T. (2014). The role of RNA structure at 5' untranslated region in microRNA-mediated gene regulation. RNA 20, 1369-1375.
    Pubmed KoreaMed CrossRef
  11. Hall T.A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95-98.
  12. Han W., Li J., Pelkey K.A., Pandey S., Chen X., Wang Y.X., Wu K., Ge L., Li T., and Castellano D., et al. (2019). Shisa7 is a GABAA receptor auxiliary subunit controlling benzodiazepine actions. Science 366, 246-250.
    Pubmed KoreaMed CrossRef
  13. Hausser J., Syed A.P., Bilen B., and Zavolan M. (2013). Analysis of CDS-located miRNA target sites suggests that they can effectively inhibit translation. Genome Res. 23, 604-615.
    Pubmed KoreaMed CrossRef
  14. Hu T., Pi W., Zhu X., Yu M., Ha H., Shi H., Choi J.H., and Tuan D. (2017). Long non-coding RNAs transcribed by ERV-9 LTR retrotransposon act in cis to modulate long-range LTR enhancer function. Nucleic Acids Res. 45, 4479-4492.
    Pubmed KoreaMed CrossRef
  15. Inoue-Murayama M., Adachi S., Mishima N., Mitani H., Takenaka O., Terao K., Hayasaka I., Ito S., and Murayama Y. (2002). Variation of variable number of tandem repeat sequences in the 3′-untranslated region of primate dopamine transporter genes that affects reporter gene expression. Neurosci. Lett. 334, 206-210.
  16. Jash A., Yun K., Sahoo A., So J.S., and Im S.H. (2012). Looping mediated interaction between the promoter and 3' UTR regulates type II collagen expression in chondrocytes. PLoS One 7, e40828.
    Pubmed KoreaMed CrossRef
  17. Jia X., Wang F., Han Y., Geng X., Li M., Shi Y., Lu L., and Chen Y. (2016). miR-137 and miR-491 negatively regulate dopamine transporter expression and function in neural cells. Neurosci. Bull. 32, 512-522.
    Pubmed KoreaMed CrossRef
  18. Jung Y.D., Lee H.E., Jo A., Hiroo I., Cha H.J., and Kim H.S. (2017). Activity analysis of LTR12C as an effective regulatory element of the RAE1 gene. Gene 634, 22-28.
    Pubmed CrossRef
  19. Kel A.E., Gossling E., Reuter I., Cheremushkin E., Kel-Margoulis O.V., and Wingender E. (2003). MATCH: a tool for searching transcription factor binding sites in DNA sequences. Nucleic Acids Res. 31, 3576-3579.
    Pubmed KoreaMed CrossRef
  20. Kim V.N. (2005). MicroRNA biogenesis: coordinated cropping and dicing. Nat. Rev. Mol. Cell Biol. 6, 376-385.
    Pubmed CrossRef
  21. Koressaar T., Lepamets M., Kaplinski L., Raime K., Andreson R., and Remm M. (2018). Primer3_masker: integrating masking of template sequence with primer design software. Bioinformatics 34, 1937-1938.
    Pubmed CrossRef
  22. Kozomara A., Birgaoanu M., and Griffiths-Jones S. (2019). miRBase: from microRNA sequences to function. Nucleic Acids Res. 47, D155-D162.
    Pubmed KoreaMed CrossRef
  23. Lander E.S., Linton L.M., Birren B., Nusbaum C., Zody M.C., Baldwin J., Devon K., Dewar K., Doyle M., and FitzHugh W., et al. (2001). Initial sequencing and analysis of the human genome. Nature 409, 860-921.
    Pubmed CrossRef
  24. Lee H.E., Jo A., Im J., Cha H.J., Kim W.J., Kim H.H., Kim D.S., Kim W., Yang T.J., and Kim H.S. (2019). Characterization of the long terminal repeat of the endogenous retrovirus-derived microRNAs in the olive flounder. Sci. Rep. 9, 14007.
    Pubmed KoreaMed CrossRef
  25. Lee I., Ajay S.S., Yook J.I., Kim H.S., Hong S.H., Kim N.H., Dhanasekaran S.M., Chinnaiyan A.M., and Athey B.D. (2009). New class of microRNA targets containing simultaneous 5'-UTR and 3'-UTR interaction sites. Genome Res. 19, 1175-1183.
    Pubmed KoreaMed CrossRef
  26. Li G., Wu X., Qian W., Cai H., Sun X., Zhang W., Tan S., Wu Z., Qian P., and Ding K., et al. (2016). CCAR1 5' UTR as a natural miRancer of miR-1254 overrides tamoxifen resistance. Cell Res. 26, 655-673.
    Pubmed KoreaMed CrossRef
  27. Liu G., Zhang R., Xu J., Wu C.I., and Lu X. (2015). Functional conservation of both CDS- and 3'-UTR-located microRNA binding sites between species. Mol. Biol. Evol. 32, 623-628.
    Pubmed CrossRef
  28. Marques A.C., Tan J., Lee S., Kong L., Heger A., and Ponting C.P. (2012). Evidence for conserved post-transcriptional roles of unitary pseudogenes and for frequent bifunctionality of mRNAs. Genome Biol. 13, R102.
    Pubmed KoreaMed CrossRef
  29. Nakamura Y., Leppert M., O'Connell P., Wolff R., Holm T., Culver M., Martin C., Fujimoto E., Hoff M., and Kumlin E., et al. (1987). Variable number of tandem repeat (VNTR) markers for human gene mapping. Science 235, 1616-1622.
    Pubmed CrossRef
  30. O'ConnellBrien J., Hayder H., Zayed Y., and Peng C. (2018). Overview of microRNA biogenesis, mechanisms of actions, and circulation. Front. Endocrinol. (Lausanne) 9, 402.
    Pubmed KoreaMed CrossRef
  31. Pacheco A., Berger R., Freedman R., and Law A.J. (2019). A VNTR regulates miR-137 expression through novel alternative splicing and contributes to risk for schizophrenia. Sci. Rep. 9, 11793.
    Pubmed KoreaMed CrossRef
  32. Petri R., Brattas P.L., Sharma Y., Jonsson M.E., Pircs K., Bengzon J., and Jakobsson J. (2019). LINE-2 transposable elements are a source of functional human microRNAs and target sites. PLoS Genet. 15, e1008036.
    Pubmed KoreaMed CrossRef
  33. Piriyapongsa J. and Jordan I.K. (2007). A family of human microRNA genes from miniature inverted-repeat transposable elements. PLoS One 2, e203.
    Pubmed KoreaMed CrossRef
  34. Piriyapongsa J., Marino-Ramirez L., and Jordan I.K. (2007). Origin and evolution of human microRNAs from transposable elements. Genetics 176, 1323-1337.
    Pubmed KoreaMed CrossRef
  35. Qin S., Jin P., Zhou X., Chen L., and Ma F. (2015). The role of transposable elements in the origin and evolution of microRNAs in human. PLoS One 10, e0131365.
    Pubmed KoreaMed CrossRef
  36. Rehmsmeier M., Steffen P., Hochsmann M., and Giegerich R. (2004). Fast and effective prediction of microRNA/target duplexes. RNA 10, 1507-1517.
    Pubmed KoreaMed CrossRef
  37. Roberts J.T., Cardin S.E., and Borchert G.M. (2014). Burgeoning evidence indicates that microRNAs were initially formed from transposable element sequences. Mob. Genet. Elements 4, e29255.
    Pubmed KoreaMed CrossRef
  38. Sabino F.C., Ribeiro A.O., Tufik S., Torres L.B., Oliveira J.A., Mello L.E., Cavalcante J.S., and Pedrazzoli M. (2014). Evolutionary history of the PER3 variable number of tandem repeats (VNTR): idiosyncratic aspect of primate molecular circadian clock. PLoS One 9, e107198.
    Pubmed KoreaMed CrossRef
  39. Salem A.M., Ismail S., Zarouk W.A., Abdul Baky O., Sayed A.A., Abd El-Hamid S., and Salem S. (2013). Genetic variants of neurotransmitter-related genes and miRNAs in Egyptian autistic patients. ScientificWorldJournal 2013, 670621.
    Pubmed KoreaMed CrossRef
  40. Schmitz L.J.M., Klaassen R.V., Ruiperez-Alonso M., Zamri A.E., Stroeder J., Rao-Ruiz P., Lodder J.C., van der Loo R.J., Mansvelder H.D., and Smit A.B., et al. (2017). The AMPA receptor-associated protein Shisa7 regulates hippocampal synaptic function and contextual memory. Elife 6, e24192.
    Pubmed KoreaMed CrossRef
  41. Shi F., Zhang Y., Wang J., Su J., Liu Z., and Wang T. (2019). RNA-sequencing identified miR-3681 as a negative regulator in the proliferation and migration of cervical cancer cells via the posttranscriptional suppression of HGFR. RSC Adv. 9, 22376-22383.
  42. Thompson P.J., Macfarlan T.S., and Lorincz M.C. (2016). Long terminal repeats: from parasitic elements to building blocks of the transcriptional regulatory repertoire. Mol. Cell 62, 766-776.
    Pubmed KoreaMed CrossRef
  43. Vaira V., Roncoroni L., Barisani D., Gaudioso G., Bosari S., Bulfamante G., Doneda L., Conte D., Tomba C., and Bardella M.T., et al. (2014). microRNA profiles in coeliac patients distinguish different clinical phenotypes and are modulated by gliadin peptides in primary duodenal fibroblasts. Clin. Sci. (Lond). 126, 417-423.
    Pubmed CrossRef
  44. Vaz C., Ahmad H.M., Sharma P., Gupta R., Kumar L., Kulshreshtha R., and Bhattacharya A. (2010). Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood. BMC Genomics 11, 288.
    Pubmed KoreaMed CrossRef
  45. Wicker T., Sabot F., Hua-Van A., Bennetzen J.L., Capy P., Chalhoub B., Flavell A., Leroy P., Morgante M., and Panaud O., et al. (2007). A unified classification system for eukaryotic transposable elements. Nat. Rev. Genet. 8, 973-982.
    Pubmed CrossRef
  46. Wingender E., Chen X., Fricke E., Geffers R., Hehl R., Liebich I., Krull M., Matys V., Michael H., and Ohnhauser R., et al. (2001). The TRANSFAC system on gene expression regulation. Nucleic Acids Res. 29, 281-283.
    Pubmed KoreaMed CrossRef
  47. Yamamura S., Imai-Sumida M., Tanaka Y., and Dahiya R. (2018). Interaction and cross-talk between non-coding RNAs. Cell. Mol. Life Sci. 75, 467-484.
    Pubmed KoreaMed CrossRef
Mol. Cells
Sep 30, 2022 Vol.45 No.9, pp. 603~672
The Target of Rapamycin Complex (TORC) is a central regulatory hub in eukaryotes, which is well conserved in diverse plant species, including tomato (Solanum lycopersicum). Inhibition of TORC genes (SlTOR, SlLST8, and SlRAPTOR) by VIGS (virus-induced gene silencing) results in early fruit ripening in tomato. The red/ orange tomatoes are early-ripened TORC-silenced fruits, while the green tomato is a control fruit. Top, left, control fruit (TRV2-myc); top, right, TRV2-SlLST8; bottom, left, TRV2-SlTOR; bottom, right, TRV2-SlRAPTOR(Choi et al., pp. 660-672).

Supplementary File

Share this article on

  • line
  • mail

Related articles in Mol. Cells

Molecules and Cells

eISSN 0219-1032
qr-code Download